Description :
From Genome Similarity Track
Location :
Scaffold_1245:4658- 5874
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1245-snap-gene-0.9Propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
1216 bases(100 bases per row)
CACTGGCCGTCCGCGAACGCCAGCGTCACGTGCTCAATGCGGTTGTTGCGCGAGCTGTTCTCGAGTTCGAGCTCGACCACCACGACCTCGGCCGTCTCGC
CGAACTGGCCGTTCACGCTCACGTACAGCACCTCGCCGAGCTCCACGAGCGAGTTGCGCTCGGCCAATGCGATGAGTCCCTCGCCCGACACGCCGCTCTG
CAGCACGCGGAAGCGGGGTACGACGCCTACGTGGCCCGAGAGGAACTCGAGCTCGTTGTCGTTCACCGAGGCAAAGCCGTGGTCGCTCGCGTCGCCACTG
GGCAACTGAATGCGGCCCGAGATCTGGCCGCTCGCGTGCGCCTTCTGCAGATGCATGACCGCACCGACGACCGTGAGGTCCTTGAGCTCGTCCTTGCTGA
GCTTGACGCCCTCAAAACCCTCGGGGTACTCTTCGGCGATGAACTTTGTCGTGATCTTGCCGCTCACGAAACGCGGGTGGCGGTACACATCCTGCAGGAA
CGACACATTGTTGCCTGGGCCGCGGATCACGTAGTTGTCCAGCGCGACCTTCATGCGCTCGAGCGCCTCGTGGCGGTCCTTGCCGTGCGTGATGAGCTTG
GAGATCATCGGGTCATAAAACATGGAGATGTCGCTGCCTTCCTTCACGCCCGAGTCCACGCGCACGCCCGGGAGATGTACGGGCTCCTGGTACTTGAGCA
GGCGGCCGATCGACGGCAGGAAGCCGCGCAGCGGGTCCTCGGCGTACACGCGACTCTCCATGGCCCAGCCGTGGATCTTGACGGGGCCCTGGAGCAGGTG
GTCCGGGNNNNNNNNNNTGAGAAGAATGTACGTCCCGTGATCCAGAAGATGCCCATGAGCAAGGTGAACGAGGGCCTCAAGATGGTGCGTGACGGCTCGG
TGCGCTACCGCGTCGTGCTCGAGAACTAAAAATCTAGAGAGGACAAATAGATCGTGACTGGATGCCTAGCAGAGAACCAAAGATCTACATAGGCGTATAC
TAATATATCGAAACTGAATGCCACATCAAAGAGAGTGCACTTCCCAACAATTTCTAGAGCGCTTGGTCGCCGACGTTCATCTGCTGAATGAAGCCTGATA
CTAGATTAAAACTGCCAAGGCCGTCAGAGGATATCTGAAGACCTCGCCACGCTCATGCTACCCCAGGCGTATTGGTCCCGCTTCAGTGGCCCAACTTCAC
CTTGAGCTAGCAGTTG