Description :
From Genome Similarity Track
Location :
Scaffold_1697:4657- 7512
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1697-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
2855 bases(100 bases per row)
GACCTCTACCGCTACGCGTCGCGTTGGGACCTGTTTCTGCTGGGCATCGGCCTCATCATGACGGTCATCAACGGCGCGCTTTTCCCGTGCATGGCGCTGA
TCTTCGGCGAAGCGATCTCGAGTTTCCAGCCGTACGACGAGTCCGCTGTGAACAACGCGGCGCTGCTGTACCTGGGTGTCGCGATCATTTTGTTCGTGAC
GGACTACCTGTCATTCGTGATGTTCTTCACGACCGCGGAGCGTCAGATGAAGGCGCTGCGTGAGCAGGGCTTTCAGCACATGCTCCACTTGGATATCACG
TGGTACGATAGCCATGATGCGCTGCAGCTCTCGAGCCGGCTCACGGGTGACACGGTCAAGATCAAGGACGGCATGGGTCAAAAACTCGGCGACTCGCTGC
GCTACACAGCGCAGTTCGTCACGGGGTACGTCATCGGCTTTGTCAAAGGCTGGGACATCTCGCTCGTCATGGCGTGCGTGATGCCCTGCATCGCGTTCTC
GCTCGCGTGGCTGCTCAAGACGCTGCGGTCGCGAACCGAGTGGGCGCAGAAAGTGTACGCTGAGGCTGGTGCCGTCGCCGAGGAGACGCTGGGCTCCATG
CGCACAGTCGTGTCTAACAATGGTGAGCGGCGTGCGATCGACAAGTATAACGCCAAGGCGCTCAAGGCCGAGGAGGAGAACATCAAGCTCGCCAAGCTCA
TGGCAGTCGTCATCGGTGTCTTCTTCTGCAGCATGTGGCTCATGTACGCCGCGGGGCTCTGGTACGGTGGCAAGCGCGTCTCGGACAACAAAGCCACACC
TGGGAGCGTCTTCAGCGCGTTCTTTGGCATTCTCATTGGCTCCATGGCGATGGCGCAGATCTCGCCAAACATTACGGCTGTGGCGCAGGCCAAGGGCGCT
GCCGCCGGGCTCTACCATATCCTGAGTACGGTCTCAAAGATCGACGCGTCCAAGGACAGCGGCGTGGTTCCAGAGAGCTGCGTGGGTGCGATCGAGGCCA
TCGGTGTAAGCTTTGCGTACCCGAGTCGTCCCGAAGCGCAGATTTTGAACAACTACAGCGTGAAGATCCAAAGCGGACAGACCGTCGCGTTCGTCGGCGC
GAGCGGCGGCGGGAAGAGCACGCTCATCGCACTTCTTGAGCGCTTTTACGATCCGCTCGCGGGTAAAATCCTGCTCGACGGCCGCGACATCACGACGCTC
AACGTCCAGTGGCTGCGCTCGCAGATCGGCATGGTCTCCCAGGAGCCCGTGCTATTTGCGACGACGATCTTTGAGAACATTGCGTTCGGAGCGAATCGAG
GAGGAGCTGCTGGAGCAGTGGTGTCGGTGACGCACGACCAGGTTGTGGCGGCGGCCAAGCTCGCGAACGCGCACGAGTTCGTCATGGCGTTGCCAAAGAA
CTACGACACGCTGGTGGGCGAGAAGGGCATCTCGCTCTCAGGTGGCCAGAAGCAGCGGATTGCGATCGCGAGAGCTATCATCCGTGAGCCAAAAATCTTG
GTGCTGGACGAGGCCACGAGCGCTTTGGACGCGGAGAGCGAGCGCGTCGTGCAAGCGGCGCTGAACGACCTCATGGACAAGACCAAGATGACGACGCTCG
TGATCGCGCATCGCCTGACGACGATCCGCCGTGCCGACAAGATCGTCGTGCTCGCTGGTGGGTGTGTCGTAGAGGAAGGGCCGCATGAGGCGCTCATGCA
GATCGACGCGGGCGTCTATCGCAACCTGTACACGATCCAGCAGAGTCCATCGGATGAAGCAGAAGATGAACAGCTTGACGAGCGTCCATCCCAGGTGGAC
GTTCTGGCTACTGAGCGGACGCAAAGCCAGGCGTCCTCTGAAGGGGCGCTGGAGGACGCTGCTGCGGCCTCAGCGGTGAACAGCACGCAGAAGAATCCGT
TCGGCAACTTCTCGGTGCTGAAAGCACTGGCGCTGTGCCGACCCGAGCGCAAGTTCTTCATCTGTGGGTGCCTCGGTGCAGCGGTTGTTGGCTGCAGCAT
GCCCGGGTCGGCGATCCTCATCAGTGGCATGGTGAGCTCCATGACGGAGAAGTACATGCTTTTCCAGGCGACCAAGGACCCCGTGTACATGGATAAGCTC
TACAGCGAGGTGCAAGTCTACGGCGCGCTGTACATCGGTGGCGCGGGCGTGCTGCTCGTGGCGACGGCGATCCAGCAGTTCTGCTTCAAGTACATGGCCG
AAAAGCTCACGTCACGTCTACGGGACATGAACTTCTCGGCGCTGTGCCGCCAGAACATTGGCTTCTTCGACGAAACGCGCAATGCCACGGGCGCGCTCAC
GGCAGACCTGGCGATAAACGCGACCAAGGTGGCGCTGCTCTCTGGCGACGCCCAGGGCCGCGTGGTGCAGGCAATCTTCACGTTCGTGGCGGCGCTCGTG
ATCTCGTTCCTACTCGGCAGCTGGTTGCTCACACTCGTGATGCTCGCGGTCTTCCCGTTGTTAATCTTCGGCCAGGTCGTGCGCGTGCAGCAGATGAAGG
GCGGCTCGGGTTCAGACTACCTCGTGGACTCGGGCGCCCACGCGTCGCAGGCGCTGAGCAACATCCGCACAATTGTGTCGCTGGGGCTCGAGGGCCAGAT
GACCGCCACCTACGGTGAGTTGCTGCAGGCGCCCATGAAGCACGGGCTGCGCGAGGCCAACGTGAACGGCCTCGCACTCGGCTTCAGCTCGTTCATCGTC
TTTGCGGTCTACTCGCTCGTGTTCTGGTACGGCGGGCAGCTCGTGGGCCGCGGCGAGATCAGCTTCCAGGAGCTCATCCGCACGCTCATGGCGATCATGA
TGTCTTCGCAGGGCATCGGCTCGGCGGCATCCTGGCTCGCGGACGCCGACAACGC