Description :
From Genome Similarity Track
Location :
Scaffold_12:465651- 468077
Sequence
2426 bases(100 bases per row)
TCTGCATGTACTTCGAGGCAAACTGGGAAGATTCTACTGCAGAATGGATAGATTTTGAACGGGATAATTGCCTCATTTGTCCAACCGCACAAACAACCGT
ATCGAAAACTGCTGGGGGAAACTTAAACAGAAAGTTGATAGGGAAAATACTATCGACGAACTGATTTCGACAGTTGTTCTACTACAAGAGTGGAGCGAAG
ATCGTTACTTTCAAGAGTTGAAGGGGATTGAAGCCAGACATACCCCTGATGCAGCTGATGCTTCAGACCCGGAACTACTTTCTCTGGTAGTTCAATTAAG
CCCCCATGATTATCGTCTAGTGGCTAACCAGTACCAATTCGCAAAGGACCCCGATATCCACTACATCATCGACAGTTCTACGCCAATCAATGCAGTTCTG
ACTTCAAACAACACTAACGACGGAAAACAACATGTGATGAATAAAGAGGTGAGACACATATTTGAACTTGCGATGTGGTATATCTGTTGTACCACAACTT
GATATTGCAGACATATCAGTGCGATTGCGCTTTCATGTTGATCTTGCTCCTCCCTTGTCAGCATGTGATATACTATCGAACACACTCTAGCCCAGAGTCC
GCAATTCCTCCTGCTAGATTTTACTCTCGACGTTGATCTATTCTGGCCCCAGAAATAATTTCACGCGTGGCTTGCTGGAAATGGCTGGGCGTCTTAAAGT
GGTTATAAAACCACAAAAAGATCGGAAAGCAATGAACCGCTCGGCTAAGTTCAGCGAGAGTCGTGTGATGTGCGAGACCATTCAAGGTTTAAGAGCAGAG
TTGCCTCAACGCGAATACGGTCAGACTCTGGGCATGCTACACAGCATCGAACGATCTATTAGGGCTGGACACATTGGATGTTTGACCGATGTTATGAAAG
TTTTTAATTCTCGTCAAGATGTATCAATTCATCCACCAGAGCGAGACGATCTGGATGGTAATACTTCCGAGCCTGTTGTCAAAGAAACCTCCGTCCGATT
CAAATTCACATCTGCTCAGCGGAAAAAGAATACACTCCGATGGAAAACAAGAAAGGAGAACAAAGCAAAGGCGCTTAAAAATACCAAGATGACTGCCCTA
AAACGGAAAGTGGTCCAATTACGACACTATGGGACGCTGGACGAATCCTCAGTGAGCATTACTTGTACTATGAGACTGCGAAAACCGTACATTATCCTTT
CAAAATTAACTGCTACCAATTTAACTTTGGGTGGTGCTCGTGCCCAACTTGCCATCAGCGCCATCAGGTACCCCTACATCATCAACTGCGCTGACATGAG
CCCATCTGCCGCGGCCAAAACCATCGCCAAGGCCTTTAAGACTACCAAATTGGTTCCATAGAAGCTGTTTGTGGCGCTCAGTTGGAGATTGCTGGTAGGA
ATGGCCCCAGTTACGTTTGACCACACGCTGCTGCATGAAGACTGAAATGCTTGGCTTCGTATAACACGACCATTCTTAAAAATCTAAAGGGAGCTCCATA
AAGTAGGCACGTCATTTTGGCGAGAGTCCTTAAAAAAACGTGCGTGTTGCGTACCAGGTAGAAGGAAAATGATGCAGATAAAAATGGCAATGTAGTCAAT
TTCTGGAGAGGCTGCTATATTGGTCTTTACGGTTCTTGACGATATTTCCAAGATGATACTTCACGTGACCACGGACAGTGACGGATATTCGCCGACATGT
CTTAGTCCGGACAGTACTCGCCTGGGCGGCACTGTGTGGACGATCCCGGATGATCCAGGATATTCCCGGATGATCCCGGATATGCTCGGATGGTCCCGGA
TATTCTCGGATATTCCCGGATGATCCCGGACGGCACAGGATATTTCCCCTGTAAAATACACTGGTGCATTTTTTACCATATTATCTGGTCTGTCTGTGCA
GCTCTCAAGTCTAACATTGCTGTCTAACCATTGGTGGCCGCACGCATTGTCCTGCAGCCTGTACGCACTTCAGCATTGTTGTCATGAACGCAGCATCCGA
AGCCAATTCGAAGGTGTTCTCGAAGGTGTTGTTAGGTACGCCCCGAGGCTTTGCTGTTCCAACAAGCTCTCACTTTTCACTTTGCTCCGTCAAGCGCACT
CGCCCAAGCTCTAAGCTCCAGTACACAAGCGCCGTCCCCCGCGGAGACGAGGAGAGGGAGGAGGAAGGAGAAGATCGCTGAAGGAATCCCGACAGCCCAT
TGTTTGTTGCTGTGGAGCTACAGGTAGATAGTTAGGTACCCGCCATATCCACAAATGCTATTCTTGGCGGACCTCCCAGTGCGGACGTAAGGCTCGAGGA
GAATGCTGCGTCGACTCGAAAGCTGCTCAACGGATGTCACGTCACGCGACCTGCATGACGATACTGCGCACCGTCCAAGTTTGCTTCGAAACAAGATGTA
ACAGAAAAGTTTCCTAGTGTCGCCGT