Description :
From Genome Similarity Track
Location :
Scaffold_733:4656- 7845
Sequence
3189 bases(100 bases per row)
CTTGTTTGACTCAGAACGGGGGCGCTTAGCAGGAGGCTTGACTTCCAGGGGTTCTTCTACCCCATTGTCGTCCTCTGCGTCGTCGTCGTCCCCTGCATCC
TCGATGTCCTCCAGAGTTTCAGGAGCGACCTCCTCCTCTTCAGAGCTATTACTAGAGGCGCTCTCCTCAAGTTCCTGGGCGGGAGGCTGGTAGTCCGGGT
CGTTCTCGATGTCGTCCACCGTGGAATCGGCGTCCTCATCAGGGTACACCATGTGGTCATCGAGGTTCCCCCAGGGTGGTGGCACATCACCGCGTCGAAG
GCACCTGTCCAGACGCTCGTCTGCCATTTCGTAGTAGGCTTCAGGGACGTACTTGCTCCAGGGAGTCAGGTCAAGACGACGCCAGTACATCATGCTCACG
AGCATCTTGATCAGCTCCGGCTGCCTGAAGTGCCCATGAGCCGCCCGGTCGCTACCAATCCACTCCATGGCTGTGTCGTACTTGAGCCCAGCAAGAATGG
CCTGACGTACGTCTGGCCGAACTTCCTTCCAGACGACACCCCCCCCTGGGAGCATCGTGTGTGCGGCCTCCTTGGACACCACAGTCTTCTCGCTGGCGCG
ACGCACAGAGTCGCGGCCTGGTTGGTGATCCTTGGGGCGACGCTGAACTTTGTTAGGCTTACGGTGCGCCGACTGCCGTGGCGACTCGCCCGGCGCCTTG
GAATCCCGTGATTTTCTGGGGCCTTGACCTTTCTTGGAATCCTGAGTTTTGCCCCCGGTCTTCGAACCGCTGCGAGGCTTGCTGCCAGGATCCGTGAGAT
CCAGAATTTCAGGACGACCAGACGATCCACGGAGGCATACGTGTGCTTTTCTCTGGGTACGGGACCACCGCAGCCTTGCGCTTGTCCATGGCCGTGACGT
TGATGACAGTGTCCCAGGATTCGGGAGGCTTCGAGTCCTTGATGCAGAGCTTGAAGCGGTCGTGGAGGCGCTCCCAATTATCCGTGAAGTCTGTGTGCTC
TTGAAGGAAATCGGAGAACTCCCAGGGGTCCACGGTGGCTGACTCAAGACGCGATTTCAGGAGTCGCACTTGTGCCTCAGAGTCGGCAAGGCGCGCCTTG
AGTTGCGCTTTCTCGGACTCCAGAGAATCAATCTCGTCTTGATACCGCGCCTTCTGCTCGCCCAGCGCGACTTTGTACTTGGACTCAGCGTCATCCACCT
TGCCCAGGGCCTCTTGGACCTCCAGGAACCAGTAGTCGCACGTGAATTTCCAGGCGCGCTTCAGTTCCTTGTACTTGCGTCGCGTATCGACTACTTCCTG
AGCGGCGGTGAAACCCTGCTGAGAGTCAACCAGAGAACGCATGTTTCGGTAGGCCCCGAGGACTCGACGCAGGTAACCAGTCATCTTGAACACGCGCTCA
GCGAGCCTTGTGCTGTTGAAGTGACGCAGGAGTGAGGCCATCTCGCGTCGAATACCGATGGAATTCAGGGTATTGTCCAGTTCGAACGCTGAAAGAGGCG
AACGACGTGGACATAGGACATCGATCCCAGCGTCGGCGCCACAGACTTCCTTCAACCCCTGAAGATCCTCGTCGGAGAGCTCCTCGAAGCCGACCAACGT
GGTCGCGCCGCCGTAGCCTTCCATGGCGAACGCGCCCGCGCGAATGTCGTTCACGACCCCTGGGACCCCCACGAGATACGCGTTGGTCTTGAGATTCGGT
GGAGCCGGCAGTTTCCAGTGCGGGGGGGGGGGGGGCGTTCAGGGACCAGGAAGTCAGGGGGATCGACCTCCTCCTGCCGAAGCATGCCTGCGAAGATGAG
TCCCCTGACGTCCTCTAGCGTCGCGTGTCGTGGTAACTTGAACTCAGGGGCGCCCTTCATGTCCACGTCTGGAGCCTTGGACTCTGAGTTCGCGTCACCC
GTTTCCTGGGTTGCAGCGTCAGTCGAGGCGTTGCCATCGGCCTCGCGCATGTCCGCGTCGGAGGTCTTGCCGGTGGCGCTGGAGAAGGAGATGAGCTTGG
TTACGCCCGTCTTGGTGCTGCCCGTCGAAGTGTCGCCGGACGCTGAGTTACCCGCCTGGCCGCTGCCGCCGCCTGTTGGTGCAGTGCTCGCAGGGGCGCC
GCCGGTGCGCTGCTGTGTCGGAGGTGGCACGCTGCCGGGGGGCGCCGTCGCTTGCTTGCCGTCCGAAGTCGCGCTCTCCGCCATGTTGACGATCTGCGAA
ATGGCGATGTGACCGCGCATTACCCGTTGGAGTTTTTGCGTTTGAGAGGAGAAACTTGAAGATAGGTCCTGATCAACCGTTGGGGAGACAGGGTGCCGCC
AAAGTGAGTGAAACCCTGGGAGTCGACAGAGTGCAACGGCCGCGTCGAAGTCGACGTTGGATGGACCTGTGTGTTTTTGTGGCCTGGCCATGGTTCACCA
GTTCGGAGCGATTTCCTCTTGATGGACCCGGACCAGGAGGGGCGGTTGACACGAGGCGGTCCCCAGAAAATTGCCGACGATGTGCCGTCACCTCTGTGAC
CTGGAGTTTGTATCGGATGCTGATTGGTGGATGACTTGGATACGGCGCGGCTGTACCCGTGTGACATGGATGGCGACTGTGGGAGAGAAGTGAATTCTCG
GGATGAATCCAGCGTCTGACCGAGGATTCACACTTCCAGCCAGTTGGGCCCATCTGCAAGCATAGTGAACAGAAGATATTTGCCCGGGGTCAAAATGTCT
TGTCTTGAGTATACCTTGGGATCAGCGGTCCAAACTTGCGATCGGCTTGCGAATCCATTGTCGCACGGCGTCGAAAGTCCTTAGACTGGGTTTAGTATGG
TGCAGGACTCCCTCTCGACTCCTCGAAAGTATCCAGTCTGTGCATCCATGACGGTTCTTCAAGGTCACGCATCATTTTGATTGCAGACTGGCTTCGAACT
GACTTGAATCCCTGAGAATCAAGTGACACTCAGGGTCATCTTCTGAAATCCTGGGGATTCTGAGGAATATTGGGGAACTGTAGGAATTCTTGGGTGTTGG
TTTGGGAAACACTTAAGTTCAGTATAAAGAGTCTGGATTTATGGTCCAAGCCCAGAGAATCATCTTTGGAACTCTGGGTCACCTGTACTCAGGGAGGTGA
ACTCTGGGTCATCGTGTGGCACTCTGGGTTTCCGCGCCCAGAATTTCAGAGAACACTCAGTCCAGCCGCGGACTTTCCCTTACGATGAG