Description :
From Genome Similarity Track
Location :
Scaffold_733:4655- 7845
Sequence
3190 bases(100 bases per row)
TCTTGTTTGACTCAGAACGGGGGCGCTTAGCAGGAGGCTTGACTTCCAGGGGTTCTTCTACCCCATTGTCGTCCTCTGCGTCGTCGTCGTCCCCTGCATC
CTCGATGTCCTCCAGAGTTTCAGGAGCGACCTCCTCCTCTTCAGAGCTATTACTAGAGGCGCTCTCCTCAAGTTCCTGGGCGGGAGGCTGGTAGTCCGGG
TCGTTCTCGATGTCGTCCACCGTGGAATCGGCGTCCTCATCAGGGTACACCATGTGGTCATCGAGGTTCCCCCAGGGTGGTGGCACATCACCGCGTCGAA
GGCACCTGTCCAGACGCTCGTCTGCCATTTCGTAGTAGGCTTCAGGGACGTACTTGCTCCAGGGAGTCAGGTCAAGACGACGCCAGTACATCATGCTCAC
GAGCATCTTGATCAGCTCCGGCTGCCTGAAGTGCCCATGAGCCGCCCGGTCGCTACCAATCCACTCCATGGCTGTGTCGTACTTGAGCCCAGCAAGAATG
GCCTGACGTACGTCTGGCCGAACTTCCTTCCAGACGACACCCCCCCCTGGGAGCATCGTGTGTGCGGCCTCCTTGGACACCACAGTCTTCTCGCTGGCGC
GACGCACAGAGTCGCGGCCTGGTTGGTGATCCTTGGGGCGACGCTGAACTTTGTTAGGCTTACGGTGCGCCGACTGCCGTGGCGACTCGCCCGGCGCCTT
GGAATCCCGTGATTTTCTGGGGCCTTGACCTTTCTTGGAATCCTGAGTTTTGCCCCCGGTCTTCGAACCGCTGCGAGGCTTGCTGCCAGGATCCGTGAGA
TCCAGAATTTCAGGACGACCAGACGATCCACGGAGGCATACGTGTGCTTTTCTCTGGGTACGGGACCACCGCAGCCTTGCGCTTGTCCATGGCCGTGACG
TTGATGACAGTGTCCCAGGATTCGGGAGGCTTCGAGTCCTTGATGCAGAGCTTGAAGCGGTCGTGGAGGCGCTCCCAATTATCCGTGAAGTCTGTGTGCT
CTTGAAGGAAATCGGAGAACTCCCAGGGGTCCACGGTGGCTGACTCAAGACGCGATTTCAGGAGTCGCACTTGTGCCTCAGAGTCGGCAAGGCGCGCCTT
GAGTTGCGCTTTCTCGGACTCCAGAGAATCAATCTCGTCTTGATACCGCGCCTTCTGCTCGCCCAGCGCGACTTTGTACTTGGACTCAGCGTCATCCACC
TTGCCCAGGGCCTCTTGGACCTCCAGGAACCAGTAGTCGCACGTGAATTTCCAGGCGCGCTTCAGTTCCTTGTACTTGCGTCGCGTATCGACTACTTCCT
GAGCGGCGGTGAAACCCTGCTGAGAGTCAACCAGAGAACGCATGTTTCGGTAGGCCCCGAGGACTCGACGCAGGTAACCAGTCATCTTGAACACGCGCTC
AGCGAGCCTTGTGCTGTTGAAGTGACGCAGGAGTGAGGCCATCTCGCGTCGAATACCGATGGAATTCAGGGTATTGTCCAGTTCGAACGCTGAAAGAGGC
GAACGACGTGGACATAGGACATCGATCCCAGCGTCGGCGCCACAGACTTCCTTCAACCCCTGAAGATCCTCGTCGGAGAGCTCCTCGAAGCCGACCAACG
TGGTCGCGCCGCCGTAGCCTTCCATGGCGAACGCGCCCGCGCGAATGTCGTTCACGACCCCTGGGACCCCCACGAGATACGCGTTGGTCTTGAGATTCGG
TGGAGCCGGCAGTTTCCAGTGCGGGGGGGGGGGGGGCGTTCAGGGACCAGGAAGTCAGGGGGATCGACCTCCTCCTGCCGAAGCATGCCTGCGAAGATGA
GTCCCCTGACGTCCTCTAGCGTCGCGTGTCGTGGTAACTTGAACTCAGGGGCGCCCTTCATGTCCACGTCTGGAGCCTTGGACTCTGAGTTCGCGTCACC
CGTTTCCTGGGTTGCAGCGTCAGTCGAGGCGTTGCCATCGGCCTCGCGCATGTCCGCGTCGGAGGTCTTGCCGGTGGCGCTGGAGAAGGAGATGAGCTTG
GTTACGCCCGTCTTGGTGCTGCCCGTCGAAGTGTCGCCGGACGCTGAGTTACCCGCCTGGCCGCTGCCGCCGCCTGTTGGTGCAGTGCTCGCAGGGGCGC
CGCCGGTGCGCTGCTGTGTCGGAGGTGGCACGCTGCCGGGGGGCGCCGTCGCTTGCTTGCCGTCCGAAGTCGCGCTCTCCGCCATGTTGACGATCTGCGA
AATGGCGATGTGACCGCGCATTACCCGTTGGAGTTTTTGCGTTTGAGAGGAGAAACTTGAAGATAGGTCCTGATCAACCGTTGGGGAGACAGGGTGCCGC
CAAAGTGAGTGAAACCCTGGGAGTCGACAGAGTGCAACGGCCGCGTCGAAGTCGACGTTGGATGGACCTGTGTGTTTTTGTGGCCTGGCCATGGTTCACC
AGTTCGGAGCGATTTCCTCTTGATGGACCCGGACCAGGAGGGGCGGTTGACACGAGGCGGTCCCCAGAAAATTGCCGACGATGTGCCGTCACCTCTGTGA
CCTGGAGTTTGTATCGGATGCTGATTGGTGGATGACTTGGATACGGCGCGGCTGTACCCGTGTGACATGGATGGCGACTGTGGGAGAGAAGTGAATTCTC
GGGATGAATCCAGCGTCTGACCGAGGATTCACACTTCCAGCCAGTTGGGCCCATCTGCAAGCATAGTGAACAGAAGATATTTGCCCGGGGTCAAAATGTC
TTGTCTTGAGTATACCTTGGGATCAGCGGTCCAAACTTGCGATCGGCTTGCGAATCCATTGTCGCACGGCGTCGAAAGTCCTTAGACTGGGTTTAGTATG
GTGCAGGACTCCCTCTCGACTCCTCGAAAGTATCCAGTCTGTGCATCCATGACGGTTCTTCAAGGTCACGCATCATTTTGATTGCAGACTGGCTTCGAAC
TGACTTGAATCCCTGAGAATCAAGTGACACTCAGGGTCATCTTCTGAAATCCTGGGGATTCTGAGGAATATTGGGGAACTGTAGGAATTCTTGGGTGTTG
GTTTGGGAAACACTTAAGTTCAGTATAAAGAGTCTGGATTTATGGTCCAAGCCCAGAGAATCATCTTTGGAACTCTGGGTCACCTGTACTCAGGGAGGTG
AACTCTGGGTCATCGTGTGGCACTCTGGGTTTCCGCGCCCAGAATTTCAGAGAACACTCAGTCCAGCCGCGGACTTTCCCTTACGATGAG