Description :
From Genome Similarity Track
Location :
contig_20:465486- 466813
Transcript NameFunction/comments
g5025.t1XP_008906783.1 hypothetical protein PPTG_12493 [Phytophthora parasitica INRA-310

Sequence
1327 bases(100 bases per row)
TTCCAGAGCGGGTGGTCGACGGCGCAGATGAATCTGGCGCAGTACAACGACACGGACGCGTGCAATGCTCGACCCGTGGTGGAAGACACGTGCCTCATGT
TCCCCGGCCATTCTAAGCTCGAGTGGACGTTCGCCGTGAACGCCTGGATCTTCGGCGCCATGCTCGGCTCTCTGTGCTGCGGCCACTTCAGTGACAAGTA
CGGCCGGAAGAAGGCTCTCATGGGCAACTGCGCCTTCATGCTCCTCGGTGGGGTCGTGCAGGCCTCGGTGTCCAACATCTGGGCGTTCGCCGTCGGTCGG
TTGATCTCCGGCTTGGCGTCTGGAACCGCTACGGGGACCATCGGAGCCTACGTGAACGAGTTGTCTCCTCCGCCCATGCGCAACACGTTGGGTCTGGGTC
TCCAGATCTTCACGACGCTCGGGATTCTAGTTCCTGCGATCTGCTTCTTCTTCGCCAACACGAGCAGTGGCTGGCGATACCTTGCCGCCTTCCCGTGCGT
CTTGGCCGTGTTGTACCTGGTTCTAGCGCCGACACTGTCAATCGAGAGTCCGGCGTGGCTGCTCACGAAAGGGCGAGCGCAGGAGGCGAGAGAGGTGATC
GCTAGTTTGTACGGCGAAGAGCATGTGAGCACGGCCATGTCGTGGCTGGAAGTGAGCAAACCGCACGCTGACGACGACTCCACCTCGAAGGAATCCATGT
TCGCCCCACGCTACCGCATGCAGCTGCTCGGAGGAGTGCTGCTCTCCTGTGCACAGCAGTTGTCGGGCATCAACGCCGTGTTCTACTACTCGGGCAGCAT
CTTCTCGGACGCCGGCATCTCGGACTCGCGCGTCGGCACGCTCATCATTAACTTCATCAATATCTGGCCGGCCTTCTTCACGGGCGTGCTGGCCAACCGC
TTCGGAGCGCGCAGCATGATCCTCTGGGGACTAGCGGGCACGGTCGTGATGGCCGTGGGCATGACGGCGTCCTTCATCGCGGATCTGCCGGCGCTGTCGG
TCGTCTTCACTGCGCTGTACGTCATCGCGTTCGGCGTGACGCTGGGGCCGCTGGTGTGGGTCATGACGGCCGACATGTTCCCCGACTCGATCCGCGCGAG
TGCCTCGTCGCTCTGCATCGGCGTCAACTGGCTGTGCAACCTGGTCGTGGGCGTGGCCTATCCCTACATCTCGGACGCGCTCGAGGACTACGCGTACGTG
CCGTTCGTGGTGCTGCTCGCCATCTTCTACCTGCTGTCGCTGAAGCTCGTGCCGGAGACGTCGGGCAAGTCCGCGGAGGAAATCCTGGCCGAGTACGACT
CGCGTCGCGGAAACAACGCACCAAACG