Description :
From Genome Similarity Track
Location :
contig_20:465454- 466720
Transcript NameFunction/comments
g5276.t1XP_008906783.1 hypothetical protein PPTG_12493 [Phytophthora parasitica INRA-310

Sequence
1266 bases(100 bases per row)
TTCCAGAGCGGGTGGTCGACGGCGCAGATGAATCTGGCGCAGTACAACGACACGGACGCGTGCAATGCTCGACCCGTGGTGGAAGACACGTGCCTCATGT
TCCCCGGCCATTCTAAGCTCGAGTGGACGTTCGCCGTGAACGCCTGGATCTTCGGCGCCATGCTCGGCTCTCTGTGCTGCGGCCACTTCAGTGACAAGTA
CGGCCGGAAGAAGGCTCTCATGGGCAACTGCGCCTTCATGCTCCTCGGTGGGGTCGTGCAGGCTTCGGTGTCCAACATCTGGGCGTTCGCCGTCGGTCGG
TTGATCTCCGGCTTGGCGTCTGGAACCGCTACGGGGACCATCGGGGCCTACGTGAACGAGTTGTCTCCTCCGCCCATGCGCAACACGTTGGGTCTGGGTC
TCCAGATCTTCACGACGCTCGGGATTCTAGTTCCTGCGATCTGCTTCTTCTTCGCCAACACGAGCAGTGGCTGGCGATACCTTGCCGCCTTCCCGTGCGT
CTTGGCCGTGCTGTACCTGGTTCTAGCGCCGACACTGTCAATCGAGAGTCCGGCGTGGCTGCTCACGAAAGGGCGAGCGCAGGAGGCGAGAGAGGTGATC
GCTAGTTTGTACGGCGAAGAGCATGTGAGCACGGCCATGTCGTGGCTGGAAGTGAGCAAACCGCACGCTGACGACGACTCCACCTCGACGGAATCCATGT
TCGCCCCACGCTACCGCATGCAGCTGCTCGGAGGAGTGCTGCTCTCCTGTGCACAGCAGTTGTCGGGCATCAACGCCGTGTTCTACTACTCGGGCAGCAT
CTTCTCGGACGCCGGCATCTCGGACTCGCGCGTCGGCACGCTCATCATCAACTTCATCAATATCTGGCCGGCCTTCTTCACGGGCGTGCTGGCCAACCGC
TTCGGAGCGCGCAACATGATCCTCTGGGGACTAGCGGGCACGGTCGTGATGGCCGTGGGCATGACGGCGTCCTTCATCGCGGATCTGCCGGCGCTGTCGG
TCGTCTTCACTGCGCTGTACGTCATCGCGTTCGGCGTGACGCTGGGGCCGCTGGTGTGGGTCATGACGGCCGACATGTTCCCCGACTCGATCCGCGCGAG
TGCCTCGTCGCTCTGCATCGGCGTCAACTGGCTGTGCAACCTGGTCGTGGGCGTGGCCTATCCCTACATCTCGGACGCGCTCGAGGACTACGCGTACGTG
CCATTCGTGGTGCTGCTCGCCATCTTCTACCTGCTGTCGCTGAAGCTCGTGCCGGAGACGTCGGGC