Description :
From Genome Similarity Track
Location :
Scaffold_974:4654- 12027
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_974-fgenesh-gene-0.0Isoform 2 of HEAT repeat-containing protein 5A
Pytiw_DAOMBR242034maker-piw_contig_974-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
7373 bases(100 bases per row)
GGAGGGATCCTCGCGGCCTACTCCGTCGCATTGAGCAGCATGTTTGAGCACTTGCCGCCCGATACGATCTCCGAACAGCAGTTCAACGAGATCACCGACG
CGACGCTCAGCATTCTCGACCACCCGTTTGCACTGGGCGATCTCACGCGCGCCCGCAATGCGGTCGGCTACGTGCTGCGCTACGGCTTGTACCCGTGCTT
GACCGAGAGACAACAGGAGACTCTGCTTGGTTCGTACCTCCAGAAACTTAAGGAAGAGGCCGCTAGTGCAGGAGAAGGCCACCACCACAAGCTACTGTCG
ATCTTGGTCGAGATCAGTCACATGCTGCAATCCATGGGCGAAGCGTGTGTGAGCCACGCGAACGACGGCACTGCGACTTTGCAGCTGCTGCTGTCCCATG
AGAAGCAGAGCGTGCGCTTCCAGGCATCTGTCGCTCTGGCATCGCTGGTGACTGCGCTGCCGTACAAGTTGAAATCGGTGCTCACGAGTTGCATCAGCGG
ACTGCGCGACACGGCCGAGTACTTGCTGCAGACGGGCTTCCCGGTCGACCCAGCGCTCGTGGCAGCAGGTGGAGATGACCAGTCGAACGGCGAGTCGAGC
AATTCGAGGAGCTTGGCGCATCTGTACATCATCCAGGGGCGATCGTCGGCGATTGCGCACATCCTGAAGGCAATCAAGCTCCAGAACGACGGTGGTCTCT
CGCACAGTGTTCTCTCCGACATCCTCGGCCTTGCTGAACGGCTCATTGAAAGCCAGTACCTCGAAGGCTGCACCGACAGTGTGTGGCTCACATGCACGCG
CGCAGGATGGACGCTCGTGGGGAGCTTGGTGGCTGTGAACGACGAGCACTGGATTCACACGAGCGTGCAGAAGCTGCTCAACCTGTGGCTCAAGTCAAGC
GTGCTGCATACGCGAGAGTCGTCACTGGAGCTGCTGCGTATCGAGGCCGCTGTGATCGCACTGAACGGATTCCTGAGTTACTGCAAGGACTTGGCGACCA
AGTCGGATAGCGTTCAGATGCTTGCAGCATACATTCTCAACGTCTTCCTCTCTGCGACACAGGATCGTCTTGGAAACCCGTTGAAGCGCCGTGGCCAAGT
CGCACGGTACCGCGTGATCACGTGGATCATCAAGTCGTTCGTGCTACTGCCGCCAATCTTCTGCGACTCGTACATCGTGCTGCTCGACCTCATCGCAGAG
TACACGGTCGCGCAGTCGCTCACGAGTCTGCGCCAGTCCTCGCTGGTCCCCGCCGAGTCGACGTTCCTGCACAATGCGCTGTCGGAAGGCGACGATTCGC
TGGAGATGGTGAGCACGACGCGCCTCGTCGCAGGCGACAATCCGAGCGTGCTTTACTCTCGCGAGCTGAACCACATTTTGGCACTGCTGCAACAAGAGAA
CGCGCTCTCAGACACGGAGCTCGAGGTCCAGTACATGGACAACTTCTGGGGCGTCGTGTGCGAGATCAACGACATGAACGACCTGTACGAGCGCGGCATC
TGCAGCAGCTTCACGTACGTGCGATTGGTGGACGCAAGTGTGTTCCTCTTTGGTCGAATCTTCCACTTTGTCCCCGAAGAGCTGCAGCTGCGCTGTCTGC
AGCACTACGCGGGCGTGCTGGTGGATGGCCGTGTCGACTGCGAAGTGAACGTGTCATCACTGCTGTTCGCTGCGATCCGCGAAGCCAAGCACGCGCACGT
TGACGCGCCGTTACCAACCGCGTTTTGGCCGCAGCAAATGCAGACGATGCTCTGTGAGATGATCTCAAGTGACAATGTGAAAGTGCGACGTAGTGCGGGT
GAAGCTTTGGGCATGCTCGCGTCCCTCGTCAGCGAACCAAACTGCAAAGCGCTGGTGCAGGAGATCGAGAAGCGTCTCGTCGCCGAGAAGCTGCCGCTCC
TCAACTCGATTTCCCCGTTTGGCGGTGGTTCTGATACCGACATGTCGGTTCTCTCAGCTGGCGCGGCCTTTGCGCTCGCGTGTATCAAGAGAGTGTGTGG
CTCCCGGATCTCAATCGATACGGGGCTCATCTTCCGATTCGCCGGCGAGATTTCCCAACCCTTACGGACCTGGATATTGCATTCCTGGAGCATCATCGTC
GAGTCTGTCGGATCTACTGGAGGGGATTACGAGCAGTACATCAAGTCAACCTCGTCGCTCATCGATGCCCACCTCCTAGCGGGGTTTAAGTACTCGAAGA
CGAACAAGCGCGGTCTCCGATGGCACATTAGTGCGAAAGTCGCGATCGGGCGGATCATCAACGGTGTTGTCGCAACTCTAGGACCGGACTTGGCCGGTTC
CGGGAAGCGTCTGCGAGAGTACTACACGATCTGGGGACTGCTGCGCCAGGACGGTGACTTGCGCGTGGAGCTCGAGTATCTCAAGTTCCTTGAGCAGGTC
GTGGTATTTGCGCCAACGCGCTTCCAGCACATGGACCTCATGTACATCCTGGGCGTTCTATCCGACGCGTTCATCCTCGCGCCTGCTGGACAGTCTGGAA
GTACTCCGCAGCCGTCGCCGTCAACGTCCTCGGCGCCGCGGTCGACTTTTGGATCAGTAGGAGAACAGCATCGTGTGAACGTGCTCATCCGAGTGAACGG
TATCGCGCGCAGCATCCTTCAACAGGTCGGCATGTCGTGCATCCGGACGCTCGTGGAGCGCGATCCGTCGCAGATCCAGCGCCAGAACCTCCAATGCCTG
CTCTTCCACGCGCTCCACGTCGAGTACAATGAGCTGACGTGGCGCTACTTACCTGGCGTACATGGCATGTGGGACTACCTCACGTTCGCATACTCCGTCC
CGGGCAAGACGCACAGTGGAGCAAAGGAGATCCGCAACACGATCCTGGCGCTCGTCGACATTGACGGTGTGAATGTTCAAGGACACCAGCTGATCGTGTG
GTCGCTCTTCTGTCGTAGCATTGCAGTGGGTGAGTCGGCGGCGTCTGCCGGTGCGGGGAGCTCGGAGCAGCTCATGATGAGCCCAAAGGGCATAGAAGGG
ATTGCGGGGCTCTCATTCTCAAGCAGTGGTGGGCCAGCAGCAGCTGACGAAGGATCTGGCTGGGGGTTTTCGAAATCCAGTGGCAACGACAAGACCCTTC
TGGCATCCGACGCGACGGCCGCGCAGCTCGAGGTTTGGAGAAATACGAAGCGAGCTGTGAGCGAGCTCATGGCATTTTTGCCGCCTCTGTCCCGCCAAGT
GCGCCATTTCGCTGTCGAGTGCGTGCTTCGTGTGTTTGAGCTCATCGCAGGTAGCAGTCTGCAAAGCTCGATGCTGCACTTTGACCTCGTTCAAGCGCGG
AACCATTTCCTCCGGCAGCTTGGCAACGACCGCACGGCGATCGCGAAAAACGAGCAAACACGTCATGAAGACGACTTTTTTTGCATGTACCTGGATGAGT
TCGTCACACTGGCTTGTCACGCTGCGACGGCATCTGCCGATGGGAGCGAGCTTCAGATGTTCCAGAGCGTTGGGCTGCAGCTCTTGAATGTGCTGGTGCA
CAAATTTGCAGCCGCCCGCGATCCAGAAGTGCACACCGGCGACGCTTTCCTGCTAGATCCGTACCAGGCGCAAATGGCATCTGCGATCCGTCAAGCGCTC
AAGCAGTCCCAGACGTCATCCACAACCATCAGCAGTGGAGGAGTCGTGGACATATATGCCCCTCTACTGATTGAAGCCCACAAGATCTGCGGCAGCTCGA
TTACCTCGCGACTGGTCCAAGACAAGGTCGCGCTGGGCAGAATCCTCAAGATGGTCGTCGTCGAAGACTTTGGCCACGGGCAGTTCATTGGCGACGAAGT
CACGCGTGTAACACTGTCGCTCGCAAACCTCTCGTGCATCGCGCAGATGTTGGTGTCCAGTATCAACCAGGCTCTTTCGGATCAGAGTGGTGGCGGACGG
CGTGGTGGTGGTGGTGGTGGGGTGGTGTCATCACCGCTCGTGAAGACGTTCCTGACCTCGTTCGCTACGAGCTCGAGCTACCTGATCGACTGCTGGAAGG
ACGCGACGCTGTCGTATGGCGCGCTCATGCGTGGCTCTGGCCAGTGGCCGCACATTGAAGACGAGAAGGAGTTCCTCCCTGGCGGCGGCGTGACGAGCTC
CAAGGTGCTCAAGACGCTGCTCCCCGTGCCCATGACCGACTCGCACTTGTTGTCCACTAGCTCAGCCGATAAGTTCCGCGAGGTGTTCCAACACTACTGG
CCCAACATCCTGAGCGGCCTCGTGCACACCCAAACGCACCTGCCGAGCTCGTTCAATGGCGGAACGGACCTGCCGAGCATCTCCAGCTTGCTGCTCGCGT
TCTCCGTGTTCCACGTCAACACGGGGATGCGAGACCGCCAGGAGGACGAGCAGCTCATCCCAGTACTCCAGACCGTGCCGCTCCTCTTGAACAGTGTGGA
ACGGGAGCAGCCGTCCGAGTTCGTGGGACTCTATCAGAGCAGCGTAAGTGCGTTGGTGAACGCTGTACTGCGGTCTTCTGGCGGAGGCGTTCGAGTGGAG
GCCTTGAAGTCGCTCTTCGTCTGCTTGAAGCCCGACATGATCGCATCGTGCGTGAGCCAAGTCGCAAATGAACCAGGAGCGACCGACAGATTGTACGCAC
TCGTCGGCCAAGCTGCGCTGTGTCCCGCCGAGGCGTTCCGCCTGATGTGCGAACCGAGCCGAGTGGCGCGCAACAGCGACGCCCATTTTGGCGAAGTGGT
GCGCTTCGCGACCGCAGGCATCGTGCTGCTCCACACGACGGAGCAGGTCCGGCGCCAGGTGGTGCACGCGATCGGGATCATCGAGCCGTGCTACCGTAGC
ATCCACGAGCGCATAGAGCTCCAGAGCGCGGTGCTGGCACTGAACCGCGCGGCGATCGAGTCCACGGTGGCTTTTTCCAAGACTTTGATCCATGGTGACG
ACCTGCTGGGAGCCATTCGCGTTGAGCTTCGCAGCAGCTTTGGCTTCTTCACCCGCTGGCTGCATGAAGAGCTAGTAGTCGCGCGCGAACGCAGCGTCGT
CGGCGGCCTGGACTTTGCCATGAAGCTACTGGCCAACTACGCGGCTGCGACGTACCCGCCTCGTCTCGCGGAGGATGCGGCGTCTTTCCACGCGGCCATC
ACGAAGAGCGCAGTTGACATGCTCGGAGTGCACCGCAGCGACGGCGAAGACCGGAACGCGCTCTTCAGCGCCCACTTGCTGATGGGGGTCGCTGGGATCG
CACGGAAACTGGTGGACGCGCAGGACTCGGAGAGGGTGCGCTGGTACTTTGCAGCGCTCGGCCCGTCGCTCGTGCAGCTCGTGGAGCAGTGGCAGGGCAG
CGCCAGTTCTATCGCGAGCTCTGTTGTGAATGCTGCGGATGCTGTGAGCGAACTGGAGCAGACCGTTGAGCTCCTTCAGCTGCTCTCGGCGCAGCTGGAC
GACGCCTTTGGGGCCGCGTTCGTGCGGCTGGTGCTGCCCAAGCTGGCTGCGGTGCTGCTCGCGCACGCCTCGAGCGAGCTCAGCGCGCAGGTGGCCGCAG
TGGTCGCCAAGCTGCTGCTGGCGTTCGCGCAGGCGCGCGGGGCCGCGTTCAAAGAGGTCGTCAGCGCCATGGACCCCGCGCTGCGCAGCGTGCTGGAGCT
CGCACTCCGCAATGCGTTGACTGGCGGCGGTGGTGCTGGCGCTTCGGCCCAGGCCGCCTCAGCAGCGCCAGGGAGACCGCTGGACCTGAGCCGCTACGGC
TGAAGAGAGATTACAGTGGTCGAATGTTAAAGTCAAAGTAGGTTGTGATAAAAATCGAGACCTCTGGTGAATATTTTCTTCACAGCTTGATTCCAGGATC
CCCAGCGTATTTATATACTTTGTGCTTGCTGGAGTACCGGACTGGAGTACCTCTTTTCTACTTCGTACTAAGTCTGTGACAGCCTACAGCGTCATGACTG
GCTTGGCTGGGCCTGGGACCTTCTGTATGCACAGCAGGTCAGTGAGTCCTCGAAGCACGGAATGCACGAACGTCATACTGGAGAACTGTTGAGGAGTGAG
CACACACAGACAGAACCAGATCTTAGTTGCCATTCGGAACGCATACACAGCAAGCAAAGCTGAGACGTACTTCAACGCGCCCGCTCTGGTCGACCGAAAC
CTCGGCCATTTCGAAACTCTGGAGCTCAAACGCCGCCATGTTGAGTGGCAGTGTCTCAAAGTACAGCTCTTCGGTCATTCGGATCAGTTCTGGAGAGGTA
CAAACCAGAGATAGTTGAGAGTGAGGCGTGCATCAGTAGAAAGTCTCTTTCTCGCTGACGTACCTGGGATCGCATTCGGAGCGCTGCTCTCCAGCTTGGC
CTGCTCGCAGAGTCGCCTCAGGGTCGCCCACGGTACTGTGAGCGTGTACTCGCGCACCATGCTGTGCTCGTCCAGGTTCTTGTACTTGAGCAGCACCGGC
TGGCTGGCTTTCTCTATGTACATAAAGGTCACAAGAGCCCAGTTAGCCAGGCAACACGCCGACCAGCATGACAGAGACCGACACTTTCGTTCCTGTACCT
GTGATCTCTTCTTCTCGCAGTAGCGAGTCCACGACCCAGTTGCGCGCGAGCCACTTGAGGTTCGCGGGCGAGATGCGGACCCGCTGCGCGCTCACGATGC
ACTGGAAGCGCGTCTGCAGCCACGCGCAGGTCCAGCTGAGCAGCTTTTCGTTGCCCCGGAGCAGCACCACGTACTGCGTCTCCTTGATCGTGCGCTGCGA
CATGGACGTCCGCTCGTTCTCCTCCTCATCGAGTGGGAAGTAGAGCACAAAGCCACCTTGGCGCTGATGTGCTGCAGTCTCATCTGCATCCTTGCCCTCG
TCGCTGCTCTGCTGCTTGGCTGTAGACGACGAGCCTCGACGTCTGCTCGGGTCGTACTTGACTGGCCCAACGAAGCCACTGATACTGGAACGGACCGTGT
CTGCAGCCTGGTGGCCGCCAGGGAGCTCCTTGAGCGGCTCCATGTCGACATCGCCGGCGTCCCGCTCCTCGAGCACGTCAAAGGCCACGTAGGCGTCCGT
GTGGCGGATGCTCACCTTGTACCCGAACTCGCGTCTGAATGCCGCGAGCGCCTCGCCGCGCAGAGACGTGACCAGGTCGTGCGCGTACGACGCGAGCTCG
TGGCGGCGGAAGTGGTACATGCGCGACATCCAGTGGATCGCCAAGCGCCGGCGCAGCAGCACGTCGCTCATGCTCGCGTCTTCTGCGCCAGCGCTGCTGC
TTCTGCTGTTGCTGGGGCTACCGATGCTGCTGTTGCGCATGGGCGCGTAGGCTGGCGGTGGTGGCGTTGCTGCTGGTGTCGTCACGACCAACGGCGGCGG
CAGCATCGAGTCGTCGTCCATCGTCGGCGCGCAGAGTGAGCTGCTGAGTCAGCTGAATGAACTGAGAGGGCGG