Description :
From Genome Similarity Track
Location :
Scaffold_268:4654- 7634
Sequence
2980 bases(100 bases per row)
GATGGCGTGACGGGTAACGTGGATGGTGAAGTTGGCCTTGCGGCCGTTCTATCGTTAACTGCTCTGTTAGAGCTAGACGAAATGTCTGTAGACAAGTTCA
GTCAGGCCTTGAAAAAAAGCAGGCGACTTATCCGATATGGTGGTCCTTAGACCCGATAATGAGTTGAACTTCTCGTCTCTATTGGATGAGACGGTCCTTG
AAAGTACAAAGGCGGCGCTTAGTGCACGAAGTGGTTCATCTATTTTGAAGACCTCTTCAGGCCCCTACTACCCTTTGATTAAGGAATTTCAAGACGTGGT
AAGTCAGAATCCACCGTTTGTATTTTCCTCCCGATAGGGGCGTACGTCATGAAATAGACTTGGTTCCTGGAACTAAATACTGCGTTACAAGGCAGTGGCC
TTTACCAGAGAAAAAACGTGACGTCATTGACGAGTTTTTTTAGTGCTAAGTACGCGGCAAGAATAGTGCGGGCGAGTAAGTCTTCTCCTTCCACACCGAC
ATTTTGTGTCAAAAAACAAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGTGGTCACTATACCGGCACAACACCCATTGCTAGAAAGGA
CGTTCTTCAGAACAACATGGCAGGGTGTACAATGTACAATGCACTCGACCTGTTCGATAGTTATTATCAACTGCTCATGCGAGCAAGTGATATCCTGCTT
ATAGCGGTTAGTACTCCAAGCGCTATGCTTTGGGAGTGGCTGGTTATGACCCAGGGACTTTTAAATGCCCTGGCTACGTAGAATCGCCTGGTGATGCAAT
TGTTCCTCCCTCACCGTGCGTATGCACAAGCATATTTCGATGACATATTTGTCCATAGTCGGGCGGAACAGGGTCGGTCGGACGTGGATAACCACATCGA
CCATTTACGAGCTGTTCTCGAGTGCACGCGCACTAATATTATTATGCATCAAAATGTATCTTTGGTGCGTATAAGATCCCATCATTTTTGTGATGCTTCA
TTTGGAAGCGAGGCCTTCGGGCAGATCCTGAAAAGTTATAGGCCATAGTGGATTGGCCAGTTCCTAAGAATCAAAAAAATCTACGCAAATGGCTTGGCCT
TGCCAATTACTTGCACAAATATAGCGAGAATTAAGCTGATATGGCTCATCCAATCTCCTTTAAAAAGGATGTGGAGTGGTGGTGGAATAGCACCGAGGCA
GAGGCTTTTAAGGCAGTAAAGGAGAGTCTCTTACATGTCCCAATTTTGGATTTACCAGATTCTGATCGGCCTTCAGCGTCGTCTGTGACGCTTCGGATTT
TGCTATTGGCTGTGATTTGTTGCGAACAGATGTTGAAAGATGCAAGCGTGTCATCGCTTTTGAATACCGTCAGCTTAAAGCTTCTGAAAAGAGCTATCTA
GTCACGACAAGGAGCTACTTGCTATGAATTATGCTCTAGTCAAATTAAGATTTCATCTGCTTGACTCTAAGCCTTTTGTAGTCTATACCCATCATGCGTC
TTTACGCACGGAGACCCAATCGCCTCACCTCTCGCAGACGATGGCCCGTTGGATTTCATTCTTTGCAGAATATAACTTCGAGGTGAAGTTTGAGCCGGGA
AAGCAAAATACGCTGGTTGATGAGCTGTCACGACGGCCCGACTATGAGCTTGCTCCTGTTGCAATTTTGTCGTCGTCAATTACTGACTTAATCCGCGCAT
CTTATGCCAAAGATGAACAATGTGTAGCTTTGCTACGTGCCCTTGGAAGCGATGAGTTTAAATACTCGGGCATAAAATTGTCGACACGTTCGCGTGCGAG
GCTACATCGATATTCTATCGATAGCGACTTGTTGGGCTATCGCACAGATGCCGCGGATACCCGCGTATCATTGTTTCTCATGATGAGGAACTGAAGTATC
GTATCCTCTATGAGGTCCACGACACAGCTATTAGCGGTCATCTCGGTCATGAGAAGACCTACGTCTTGGTTAGCCAGAGTTATTGGTAGGCCAAACTCTA
TAAATGGGTAAGCACTTATGTGCGCACATGTGAGACGTGCCAACAGGTCAAACACTCGGCACATGGGACTGCGCCGCTGGCTAGTTTGCCTGTACCCTCG
GGGTGTTGGGAGTCCATCAGCATGAACTTCGTGTTTGTCCTACCAGAGGATTCGGACGGCACCACATGTATTGTGGTCTTTGTCGACCGTTTGAGCAAGA
TGGCTCACTTAACGGCTGTGCCGGACTCCATTGATGGTGAAGGTACAGATTTGCTGTTCATTGATCGTGTGTTTTGACAACACGGCCTGCCATAGCAATT
GTCTCTGACAGAGATCCTCGATTTACGGCCAAGTTCTTGAAAGCCATCTTCAAGGTGCTCGGCACCAGATTAAACATGTCTACCTCGGATCATCCACAGA
CCGATGGTCAGACTGAGCGTGTCAATCGCTCAGACGCTGAGATGCCTCGGCGTTGGAGCTCAATGCTCCCCATTGTTGAGTTCGCCATGAACAATGCAGT
TCATGCCTCGACAGGCTATACTCCGTTCTACGTGAACGGCCCCACACACCCACACGTTCCGTTGACGCTACCACTACGTGGCTCAGGGCTTGGTGGGGGA
GAGGTAGCCGATTGGCTTGCTGATATCAGCTTTTCTACTGTTCAAAAACAGGTTAGCGCGTTCCACACAACGCGATTGAATGTTCTACGACATGTGCGTG
ACGCAATGGCTGATAGCCAAAACAAACAGAAGAAACAAGCGGATGCTAAAGGCAGAAGCTGTATTGAAAGTTATGAGGTCGGTGACCAAGTCTTATTAAA
CACTAAAAACCTACCTACAAATGTAGTGTCTGCTGTGTTTAAGACTAAGCTGCGTCCTCGCTTCATTGGACCATTTACGGTCGTGGCTAAGAACGGTATT
GCGTATACGCTCAACTTACCGCGCAAATTGTGTACACACCCCGTGTTTTACGTTTGCTTCCTTAAGCCGTATCGGGATCC