Description :
From Genome Similarity Track
Location :
contig_162:4654- 7116
Transcript NameFunction/comments
g11832.t1hypothetical protein

Sequence
2462 bases(100 bases per row)
TTCGACGTGCAACCCACCATACTAAGACCAAGTCAACCTGAATGCGAGTGCGCGGACACGACGAAGGAGACCGCCAAGAATCCAGTAGACCAAGTCAGAC
AGAAGAAGAAGATAGTGATAAGAAGAAAACAGAGTTTGTTTTGCGTTGGAAGTGAGAAGTGGTGCCTTGTCGGCCCCCTTGCTTTGAGCGTACTGCGTTG
AGGAAGACTGCTGCGACCTATAGCGACTACTACGAGGCTGCGACCCGGGAGCGCTGGCGTATCGGACGACCAAGACCGCACGAAGATCGAGGAACCCGTG
CGAAAACTCTCACCTAAGTCTAAGTCCCATTTAGGTGGGGACCAGGAACTCGTATCCCTGGATTGATCCGCCTATTTCATTTGTCAGTTGACTGTGGTTG
CTTTAGAGTGACTGCTTTCATTTCATATTCACCTACGATTCGGGAGGTTATTAGCAATCCCCCTGGATTTTGATAGTAGATTGCTGTGTGGTTCGAAGGA
ACTTGTATATTTCTCCCATCCGGGAGTGGTGCGCGGAGGCATCCCGAATTTACCTGTATTCGGGACTGTAACTCATTCGGACAGGCTGTATATTGTGAGT
GTATAACAAACTCTGTTGTTGTTTCTGTATTGCTTTTGGTTATATTGGAGAAGGTCTTTGTTCGTGACCCCACTCCCAGCCAAGACACTCCGGACTGTTA
GAGTCTGGTAGTCTCTCTACATATCTACGTATCCTGATCGAAGAACATCCCAAAGGTCAAAGCCCGGTCCGTCGAAGATAAACGACACCGATAGGGATTA
CTTCAAGGTCACACGCCAAATCTCGGGGCAGACACTAGTTGTCTGCATTCGGGATTCTGACCCCGGCATCCGGACGCTCCCTCCTAGAGGAACGGGTACT
CCCGAAGCGTTCGGGTCGTCTGAGTTCTCGAAGCTCGTTCGTCTGCCGGCACGACTGTACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAGAG
ACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCTGTCGCTCCATTGATGGAACGAATGCGCGTAGCTCTTCATGGTGTCAACCAACACGC
GGTTGACACGCTCTGTTTGTCCGTCGGTCTGTGGTGATCCGCAGCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAACCGCGCTG
TAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGTGTCTAAACACCATGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACT
GCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAA
TGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAGGCACGAACGTA
CTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGG
TACTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTA
CACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAAAGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCAT
CATGCGCGTGTGCGGCCTTCACGTCATCCAACAAGGACGACGACGGAATAGTCGGCCTCTTGCACCGTATAACCTGGTCGACGCGAAAGCACGTCGGCCA
CGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGAC
CGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGT
TCCTTGTCATGTACCGGGTAATTACGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACCGATCACGACCTTCGTGATCGAGTTGCATCAGTGC
GCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACT
GCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGT
ACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTA