Description :
From Genome Similarity Track
Location :
scaffold_5:465331- 466745
Sequence
1414 bases(100 bases per row)
AAACATGCTATTTGCCACCTTAGACGTGTGCGGCTTTGGTGCCGACGATATTCTCTGTCTGAGCTGGATGGTATAAAGGCTGATTTCGCAATTGTAAAGG
CCATTGTTAATTGGTCAGTACCTCTGTTCCAAAAGAACTTAAGAAAGTGTTTTGGACTGGCCAACTACTTACGCGAGTAGCGTACAAATAACGTCGACAG
GGTACAAATCACCGCTTATCTCTTAAAAAAAAGCTGAAAGTAGTGTCGGTGTACGATGGAAGAGGCGATCTCCAAGGTTGAGAGAGAATGATCATGTGCC
TTACAAATCTAGCTTTCCTGGATCTAGCACGTTCATTTCACGAGGTCGGAGTCGCTACAGACAACGTAATAGGCTGTCAATGGGTATTGTGATCGCGTCG
AAGTCTCGCCAGATAAAAGCTGCTGAGAAGAGCCATTTCTGTCTATAACAATGAGCTTATTGCAATGAAAGAAGCCCCTGCCAAATTTAAGGCGCACTTA
CTTGGTGCTAAGCCAGTTGTGATCTGTACAGgtcatgcgtcgttgcgcGCAGCAACGTCTTTGCCACACATCTCTCAGTTAAGTTATGGTGGCAATTCGT
ATTACCGAATACAGCTGTAAGGTATGAAATATCAGCCGGACCGGCTTGATGCAGTGGCGGATGCACTTTTGCGTCGGTCCGACTTCACTTGTCGCTTGTA
ACAACGCTGACGGTGCCAATTTATAAGGCGATACGTAAAAGGCAATAAATGCTGCGCTGCTGAAGCTTTAGGAAAGAAATTGTTTTCAAACTTAAAATCG
GCTAAATTAAAGCGCGCGGTTTCACATCTTCACCGCTCCGTCGTTCCCGAATGCTTGCTGTATCACAGCATTGTTACTCAGCGTGAAGTTGTACCTCATG
ACGAGGACTACATAACATAAAGGTATGAGAAACATGACAACTCTTTAGGTGACCATCTCGAAAGAGGAAGACATACTGCTCGGAGCGCTATGTATTTGGT
AGCTTTAGCACGCAGAAGTGGGCAAGCACATATTTGTGCAGCGATAACGTGCTAGCGGATTGATCTATTCCGCAAGTGGCAGCGCCTTTTGCCAGCCTGT
CGGTCCTAGCAGAGTGCTGTCAATAAAGACTTTACATTCGGTCTCCCAAAAGCCACATCCGTAAGTATACCGGTATCTTTGTGTCTGTGGACTgcctgag
caagatggttcgatTTGCTGCTATCAGCGACAATGTGATCGGTGAGGAAACAGCCAAGCTGGTTCTCGACAAACTTTTTTTGCCGTTATGGATAGAGATG
TGCACTTCAAAGCAAACTTTTGGCAAACATGAATCAAGCTGCTTGGCACCAGAATAGATATATTAATCGTTGACCATTGGAAAGCAGTTGGCTGGGCCGA
ACGCTTACATCGCG