Description :
From Genome Similarity Track
Location :
Scaffold_259:4653- 9056
Transcript NameFunction/comments
Phymu_g7658DEAD/DEAH box RNA helicase, putative
Phymu_g7659Putative beta-1,4-galactosyltransferase
Phymu_g7660flagellar radial spoke protein

Sequence
4403 bases(100 bases per row)
TTAGTGCAGGCAGCAAAAATCTCGTCAACCTGTTCCACAAAACCCAGCTCCAGAAGTctgtcggcttcgtccaAACACACCATCTCAACGGTCGACAACT
CCACCTTCGCTTCTTGGATCAAATGCACAAGTCGGAGTGGGGTGGCAATCAGAACGTCGTGGTTTACAGCCAGCTTACTTTTGGTCTGGGAAGCAATGGT
AGCTGCAGTGGCCTTGGACAGTAGTGTGATGTGCAACTTCTTGCCAGTAGCGAGGCGAGTAAATTCGGCACGAATCTGCACCGCCAGATCACGAGTAGGA
GCCAGCACGATGGATCGGATTCCACTGCTGGTGCCACCACCGGCTGCAAGGTTGGCGAGGATTGGGATTGCAAACGCTGCCGTTTTACCAGAACCTGTAG
GTGCCGTGGCCAGCAGATCGCGACGAAGCAAAAAGCTTGGGATGGCTTGCATTTGCACAGACGTGGGCTCCTTGTATTCCGAGCGTTCAATATTCTGCAA
AAGCAAACGTTTCATCTGCTGCGCATTTGGACTCGAATCCAATTGCATTTCAGTGAACGAGGTGATCGGTGCTGGTACACTCACTCCACTCACGCGAATG
CCAAGCTGACGTCGGATCAACTGCACACTTTCCCTGTTTGCAAAAATACACAGTGAGAATTCAACAGCGACAATATTTCCATCAGCATCATACGTACTGt
tcagaagcagcagtgttgttcttggcgaccttcttggtctctttcttcattttcttcgCATCCGTTGGTTCCTCGCTCGCGTCCTCGCCATTCGACTTGA
ATAAAGCGACAgcctcctcctgttcctcATCGCTGTCACTAACTCCATCAGAGTCTTCTTCAGGTTGCTGATAGACAGTCTCACTTCCCATCGAATCTGT
GCGTGAGCGACGACGTGCAcgcttctccttgcgcttctcaGTCTTGGTTTTGGGTGGAGCAAGCAGTTGAGACGCCTGCTGTcgtgcttcatcttcaaga
cgctgctcctccagcgctcCTTCACTTAGTTTGCGCTTGCGACGGGGCTTGCTGCCTTTCACCTTACGGGGCTTGCTAGCGGCCTCGTTGCCCGCCCACT
CCGGTACCATGTCGACACTGATCTTTCGTGGCTTGGGTGCCTTCTCTTTAGGCTTGGGGGCAGCATCAAAGCCAAAAAAGTCAAGTTCGTCCACGGCAGC
AGTCTTTTTGATATCTGTCTTAGTATCTGCGCCTGAGAAGTATTGCGATAGGCACGAAATCAATTGAAAAACAATAGTTTTGTTAGAAATGGAGAGATCC
GATCGACGACGTATTACTACGGCTACAGAGAGAGATGGCGAGTGCCGATTGCACGAGGGAGGAGAACGAACCTTCGGCCAGCTGCTTGAAttgcttcttg
tccttctgGAACCTGGAGCCACCGAATTTGGCGCCTTGAGTGAGTGCTCCGAAGAAGGTGCTCGACATGATTAGCTTTGGCGTTTGCGTCCAGCCAAAAA
TGCTGAAGGGTCACTATTAAGGGTGGTTTTCACCCAATCACAGCTCGTTTCTTGTTCAGACCATATTAAATTGGGCAAAATGCAATATATTGCTGTACGA
AAGGAACTTTCACAGCACAACATATTATGGGCcaatgttgaagctgctctttgGTTTGGTGACAGCTACATGCACTGGTTTGGCACGGTAGTGCTGGCTT
CACTTTACAATCATTCGTTCAGTTGAGCTCCATCGGGacctccttcagctgcggTTTCGCACGCTGTCGTAGGGACGGTGAGAACCAAGTACGATTCCAA
GTCTTGATCGGGGGCTGTTGGATGCTCCAACGACGATCTGGAGTCTGACCAGTGGCCATTAGGGCCTAGCTTGAGGGTGATTTTGGTGCAGTGTTCGTTG
ATTGCTTCAGCGTCCACGTACTCATAGTGGAGATTCTTCAggccgttcttcttccatgTGCGGTGGTGCTCCTTCAGTAGGTCGCGCTTCACGGTGCACT
TCCACTTGCCTGTACGAAGTACTGTCAGCTTATCTTCCAGACTTAGTTCTTCGAGGTCTCGAATGGTGCCACTGAAAAAGAGAGCATAATTACAGTAAGT
CGATGAAACTAGCCCATAGTCCAGCAACGCGTCAATAAACTAGAGAAAAACTCACCTCGCCGGTTTCTGGATAGAGAGCTTTTTACGGACCACGCGACTG
TAAAGCTCGTTGTCCTCGCCGCCCCAGCCCCAGAAATTGTTGGGGAAACCATTGACCTTAATAAATTGCTGGCGCGTGAACGCTACAATGCCGCCGAAAT
AGTTGTCGCTCTCACTGTAGCGTTCCCACATTCGTGCGATATGCATTGGGCCAAGGGATGGCGCCATGGTATAGTATTCACCCAGATCCTCCTGATACAA
TAACGTCTGTTGAATTGCCACCAAATGGTATGTGATCCCCAATACAACAGAGTTCTTCACACTTACTCCAGGAAGCAGATCCACGTCGTGAAAGATGTAc
acgtcgtagtcgtcgcGAGCTATGTCAAAGCcggcgttcagcagcttgccTCTATTAAATTTGCGGCCATCCAGAGACTGCTCCAGGATGAAAATATGGA
AGGAGGCACTAAGCAATGCAGACCACAATAAGTCAGCGAATTCAACAATAAATTGGTTGGCCAAGAGCATTACATGTATCAATCCCCTACCTCTTCAAGG
CGCAGTGTCGCTGCAGAAACTTCGTCATGTACGGgacgaactcgtccagatgCGCTTGTCGCTTCTGCGCCGGGTGGTTGTCCCGGAACGGTACCAGTAC
CGCCACACGTGTGAGTTCCTGCATTGCAGCACTGCTGCGATTGtctggtgctggcgtcgctgttgTCTTTTCTGGAGCAGGAACACTAGTGTGAGGCGAG
TTGGGCAGCTCATTTTCATCTAGACAGGCGGCGTCATTCGGGCGTCGCTGCCTTTTCTTGCTGATGTCGTCATGCGATACGAAGGACCGTTTGGACGCCA
TGCGCTGTAGGACGAAAAAAACTGGTAGATGCCCACACGGAGGAGGACAGAGCTTAAACCATCCAGTGGTTGGATACGCATACGCGCAATCCCGTCCTTG
TCGAGGGAGATGCTAACCTTCTCTCGGCTCAACGAACACAAATACCTATTGTTGCGCTCGTGCCTGCTACTTGTGCTCGCACTTGATCAAGACATCGAAA
ACCATGTGATCACAAGTTTTTCTCGATATCTTGACTTTTGTATTGGAGCTACGAAGTCATATTTGTCTACCTCTATCACTACATATCTTGTAGCAATCAA
TTGTCAGAATAGCTGCTTCAACGTAGCTTCTGCTCGAATTCTGCCGACGTAAGGCCCAGAATCTGGCCGAAGAGTGCGTCAGGAGTGCTGTTTTTCATCA
TGGATCGACCCACACGGCGCCGATAACTCGTATCCATCTCTCCCATCCGTCGAAGCACGTCCACAATGCCTTGCTGAGTCTCCGCTGGCACCTCGCTTTC
GACCAGTGCCTTCACGAGATTGTCTAGCATATCCAAGGTTTGAACAATGCGGCTAGCCATCCCATATGCGTCTTTCTTCTGGATCGCAGTCAGTGCCTTC
ACTGCGGCGGGAGTGTCCTCGTCATCGAAACTGCTCACGTTCTTGTCCAGAGCTGGCACCGCCGCGATACCCAAGACATCCGCCAGCAGATCTGGGGAGT
GGAGAAGTCTCTGGGTAAATGGAGCCACTCCGCGAGGCAGTTCGCACGCTGAATTGATGGCAATAATAGCATTCTGGCGCACTGAAGTGCTTGAGTGAGT
AAGACATTGGGCAAGCGGCTCGATGCCGACTTCAATGATGCGCGGCTTGGCGTCCTCGGAGGTTGACAACGCCATCACTGCCGAAACGAGGCAACGAGTA
AGCTCGTCTCGCTTTTCAACTGGATCACAGCGCACTTGCCCTAGAAGAACCTTCGAGAGCGCCTTTAGACACTGTTCCACAGCGCCCAACTGGATAACCT
CGCGCTTGGCCTGGTTGTACGCAGCTACGTTCGTGATCACCATCGCGGCGTGCATCAGCGTTTCGGCTGGACACAACCGTGGCTTCTTGACCAACGACAC
CACTGGTGTGAGAACGGGAAATTGCGTACAAGTGCGAGAGCCTTCGTAGATACGAGTGAGATttgccagcacttccacAACGAGCTGGACAATTCGGCTA
GATACATTTGACAAGGGCTTTGTTGTCAGCATATTTGCCAACGTAGTTACAGCCTCAATCTTGCTAGCAAGCAGTAGGCAGCCTTCATTGGAGACAGTCA
AGTTGATAAAGATAcggcagccagcagcaacgacatcttcttcgtcgtcacctAGCAACCGCGCTGCTGTGGTCAGAACAACTTCATCGCTTAATTCGTT
CGG