Description :
From Genome Similarity Track
Location :
Scaffold_610:4653- 7906
Sequence
3253 bases(100 bases per row)
CGCAAAAAGCGCCGATCTCGATTCGGAGCGCGTTGGAAAACCTTCCTCAAAACCATCCTAGCGAGGATGATCGCTGGCCATTGTGATTTGGACATCATGA
TCGATCCGTTCTTTTTACATTTCCCTCGCCCGCACAAATCCCTTGTCTGGTACCCCGGGTTAGGAAGAACTACAGATCCTGCTAGTTTGATCGAGGCACT
CGAGATCGCGGATCGTGAGGAACCTTGGCGTCTTCACTTTCGCCACACGATTCAACATCACTCGGGTACGTTGCTCCCACGCATCCGCAACAAATGCACA
CTGGTTAATCCAGAGTAATATCATATCAACGTCTGGTCATAGCACTCCACCATTGTTAATAGAATTGTCAGTTCAACTTCAATCATACGTCTTCTTCTCA
ATCTGTTCTCATCATCTTACTTTCAATACCCACAGGTAAGCTGGTAATTCCTTCAAATTCTCATGCACACATAAAACAACCCCATCCTCCGGCATATGCT
ACCCCCTAGCACACCCTTCACTCCCTCATAGGGCTCTTCTGATACACCCTCGTGCGATTGCATCATTTCGAAACGACTTCGACTTACTCGATCCCTTTCA
AACTCTTGCAAAAGAGCTCCACAGTCAGGTCAGCTTCGTCCACCCAACTCGGATCGGGATATCCTTTTCATTTTACCAGAAATTGACGGTGTATTCGCCC
ATAGCGAGTTTTCCGGCCAGATATCAAATCTACTATCCGCTTTACCTCAACTCGCCTTCGTCGAGATCGCCTTCCCAGCTATCCTCTGGTAGTAACGCTT
CGTCAAAGTCAAAACGATTCTCTTCTTCCACCATCACTTTCTCTTTGGTCGTTCAGGGAAAACTCGCAGCCGTCTCAGCTTTGACAAATGTACGATCGGA
AACAGTCGATAGGAGGTGTCGGCGATCTCCAGTCGTACCGCGTGATCACTACACATCTCCGCCACCCGAAAAGTCCCATGCCACATGTGCGCCAATTTTC
TCGCATACCCTTCTTTTACTCGATCCAGATATAACCACACCTGCGAACCCACTTCGATCCCGTGTTGATCCAGATCCTCATTGTGTCGATCTGCTCGTTC
TCGGATTGAAGCTTTCAATCGTCCATTCACCTCTTTTCTTGCTCGTTGGTCATGTCTCTGTATGCAATATCGCCATCCTTTCGGGGCGATCTCGTGCTCC
GGTATTTCCCACCGCCAATGTAGCTTCTAGTGTAGATCGCGGGTCCCATTTGTGGATCAGATAGAAAGGTGTCTCCCCTCGAATCCGATCTTGAGCCGTA
TTCATTGCGAATGTGAGGCGTTCCGCGTACTCATCCCAGCCCTGTTGGTTGATATCTGAGACATACATCTTGAGTGAACGTGTCAGCGTTTGCACCATAC
GTTCTGCCGTTCCGTTGGCTTGGGGTCGATATGCCATTGTACCTGCCCCACGATCCGATTGAACACGCGAAAGAAATCGGACATGAATCCTGGTTCTCGA
TCATGTCTTATAGCTTCACTCTTCCCGAAACGGCGAAACACACATTCTTCATAGTTTCCCGCAATCGTCTGCGCCGTTCGGGATGAGCAAGCTCTCGCGA
TAACATACCCTGAAAAGAGATCGACCCAGATAAGTAGCTCTGTATTCCCTTTGCAGGATTTCGGCAGCGACGGAATGTGGTCCACGGCTATGATCTGGAA
AGGGTAGGTCGCTTGTAGATTGCCGGGCGACTTTCCTTGGATCATCGGGCACCCTTTTACTGTCTCGCAGTCCGTACATTCTCCCAGCGTACAACGGTAC
GCTCCGATATAATCCTCTCCAGTGGAAACGTGATCTGATCCGCTGGTAAGTCCGGCTGATCCCTTGGTGGCCTCTCTCCAGTCTGGCGTGATAATGACGC
AAGAAGTCTTGTTGTAATTTCTCCAGTATTACTAGACGCACCAAACCTTCTCGATCTTCTGTCTCTCTTTTCGCTATCGGACAGAAAAACAGCAGATCGT
TCTCGCCAATCTCATAGTCCGGAGAGATCTTAGCGCATGTCTTCGCTTCGTCTGAACTCAGATTAGATACATCGCCCACTAGATATTTCTTCAGGTTGAC
GATCCAGAGTTTCTCCTCTTGGGCTTGGCGAATTCGTTCGCTTCTTATTCTCTGCACCAGTGCTTCTTGTAGGATATCAGGCGGATGACGTCTCTTCTGC
AACGATCTCGTAATTACAGTAATCTTAGCGATAATATCGCCCTGCCTTGGTTTTAACAGTTCGTCCAAGCGGTTCAGAGTAACCAGATCTCGGCGATCTT
CTTCGGTCATTATGACTGTCTTTTTTTCCTTTTGTAAATCTGTACTGGCCAGCCGATCTGCACTTTGGTTCCAATCCCACTTCATATGCAGGAACTCATG
GATCGGCCAGGATCAAAGATTCTCTAGCGCCCGATGTCGTAAAAGTTGGAGGCCGGGCGCTTTGCAATCGGTCTCACCTCGCATCTGCTGGATGACCAGG
TTGGAGTCGCCGCATATAATAACTCGCCCCCGGTCCAGATCGGCAAGCAAGTCGAAGCATAAAAGCATTCCATTATATTCAGCTTCATTCTCCGTGGAAT
CGGTCACGAATCTGGATTCCACCGACACACACGATCGTCCATTCTGGGAGCTACCATAGGACCGCTCTATATATACCCCCTCTTTTCTTGGAATTCTTGC
CGACCCATCGAAGCTGGCTACTATTAGACTTCCGCCTTCTTCTAAAGTCGGTGGAGGCATAATTATCTTATGCCGAAAATCTTTTCGTGGAGCGATTACG
ATCAACACCTCTTCGATCTCTTCACGCGGGGTTTATGCTGGCTACTAACGCTCCCAGGATCTTGTCTTCTCCTTTTTTGCATCTCTTCACTTCCTTGGTC
CAGTTCGATAGCAAAGTAGCCCAACGTCCTAAGTTCCATTGAAACCTCGAGATACATCAGCCATGCCAAGGTCGAATGTCGTGTCAGTACTATCAGTTCT
CTTGAGACTAGCATAGTATAACGCACGTCCAAGATGCGAAGTAGTGCCAATATTTCCTTCTCTACTGTCCCATAGTTGAGTTCGTTCGCCTTCAGCGTTC
GACTGGTGAAAGTAACTGGCCAATACACGCCATCATACTCTTGCATCAGGGTAGCTGAGACCGCCCACTTGCAGGCATAAACCACAATCACTGGAGGGCG
ATCTGGGTCAAAATGTCTCAGCGTCGGGGTTTTAGCTATTTTCGTCTTCAACA