Description :
From Genome Similarity Track
Location :
Scaffold_21:46520- 47653
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_21-fgenesh-gene-0.20Small nuclear ribonucleoprotein Sm D1

Sequence
1133 bases(100 bases per row)
GAATGGCAGCCACACGACGATCTGAAGCCGCGTGCACTGAGCTCCGCCATGCTCTTCATCTCCCACGCGCGCCTCTGGTCTTCGGCGACTGCTGCTGCTA
GCGCCATCTTCTGATCGCCGACCTGGCTGCGATCTCTTTTTCTCCTCATGTGCATCGTGTTTCTTCGCTTGCACGCCTTTGTCCTCTGTTGTCCTCCTCT
CTGCTCCTAGCTGCATCTTCGCTCTCGTGACTGCGACCTGCTGCTCCTATTGCAATCACGGTCGGCCGCGTCCTCGTCCACGACCACGGCCTCGCCCGCC
GCGACCACCAGCGGCTGGGGCGCCGGCCTTGACCTTCTCGCGCGGTGTATCTTCAATCAGGAGCGTGTCCAGATTCAGCGAGTCCGGTAATATATAGTAG
CGGATGTTGTTGCCGCGGATACTTAACGAGTCGAGGCTCACGGGGTTCTTGCCCTTGACGGTCATCTTGACGGCCTTCAGGTGGGTGTTCATGCTAATGT
CCACGCCTGCACGCACAGCGTAATTCCTAATATTAGTGCCCACAGAAAGACAGACAGACAAGTAACGCACGTGCACACGGACGCACCAGTGATGGTGCCA
TGGATGATCGTTCCGTTCTTGAGCTCGATCGTGACCGTCTCGTTCGAGAGCTTCATCAAAAATCTACAACCGCAAGCAGCGCACATTGTCAGCACAGCAG
CACACCACAGACACCAGCAATTCAACGCAGTGGCACTTGAGTGCACGTGCGACCTAGTCCATAGGTACATACACACAGCACAAGAGCTGCTCTAGAGAGA
AGAGCGTACCTGACGAGCTTCATGGCGCCGACCTGCTTGCTGCTTTTCCGACTTTCCACTGGACGACTCCCCTTTGCCAGCCCCCTGGTGGATTGACAGT
ACAGTAAATACTCCGCTTTGTCTCTATGGCAGGTGCTATTTTTACTTCTTGCCATTATTCACCAATCGATATTTAACTATTTTTGCTTCATTTTGAGGTA
ACAAATATAATTTGAACGCTCAGAAATTCTGTCCAAAAGCTTTGGTATACCGATATCACATATAATACCGGTACAAGTAATGGATGGACCGATCTTTTTT
GGTCCCAGTTTATATATTGCGATAGCCACCCAC