Description :
From Genome Similarity Track
Location :
Scaffold_224:46508- 47833
Transcript NameFunction/comments
Phypl_g5565hypothetical protein PHYSODRAFT_288740

Sequence
1325 bases(100 bases per row)
GCTGCAATATGCTGCGAGCTTATTCCACAgtcagcaccttgagcatGTTGGTCGAGCCCGAGCGTGCCTCCACCATGCCGTGCagggcgacgacgttgtC
GCCGGGCTTCACCCAGCCGAACTGCTTGCCCAGATCCGTGGCGCGGAACAGGATCGAGTCCGTGCCGATCATCGAGCCCATGCAGCGCGCAGTGACACCC
TTATTGAAGCCCTCCGCCTGGCGGGCAGTTCCGCCCAGAGCCGTaagcaccagcaccggcaTCGAAGGACGGAATTTGGACACCAGACGGGCCGTGTTAC
CCGactccgtcagcaccacgATCATCTTGGCGTTGATATCGATGGCCGTCTTCACAGCCGACGACGCGATCGCCTCCTGTGTGGACATCGGGCCGTACGT
GTCGAGCACCGAGTTGTGTAGAGCCTGGTACAGCTCGTTGTAGTGGATAGCGCCCTCAGCCTGCACGCAAATCTTAGACATCATTGACACGGCCTCTGTC
GGGTAGTCGCCGTTGGCAGTTTCGCCCGACAGCATCACGGCGTCCGTGCCGTCAAGCACGGCGTTGGCCACATCCGTGCACTCTGCGCGAGTGGGTCGAG
GCGCCTTGATCATCGACTCCAGCATCTGCGTGGCCGTCACTACCGGCTTGCCAGCGATGTTGGCCTTACGGATCATCATCTTCTGCGCAAGGAAAACCTT
CTCAGGTGGGATCTCCATGCCCAGGTCACCGCGGGCAACCATAATGCCGTCCGTCCTGGCCAAGATATCGTCAAAGTTCTCGAGTCCTTCCTGACTCTCA
ATCTTGGCAATGATCTTGATGGCGCGGCCGCGAGggcccagcacctcgcggaTGTTGTCGATATCCTGGCCCGTCCGCACGAACGACGCGGCAATGTAGT
CCACGCCGTGCACCAAGCCGAAGTTCACcaggtcgtcctcgtccttctccgtgAGGGTCGGCAGCATCACCTTGCATCCCGGTAGGTTCATGTTCTTGCG
CTCACCGAGCGTGGCCGTGTTGTTGGCCCGAgtcacgacgccgtcctcctTGATCGCCGTGACCGTGAGCACGAGCGAGCCGTCGGCCACGAGGATGGAT
CCGCCGACCTTGACGgactgcggcagctccgggtACGAGCAGGCGATCTTGGTCTCATCACCGAGGAACTCGTAGTCCGTggtgagctccagcgtcgagc
cCTTCTTGATGGTGaccttgtccttgttggCCAGGAAGCCCGTGCGGATCTCCGGGCCCTTGGTGTCCAGCATGAGGGCGATGTTCTTGTGCGGgcgcgt
ggccagcgcggcgcgcAGGCGGTTG