Description :
From Genome Similarity Track
Location :
Scaffold_5:465060- 468242
Transcript NameFunction/comments
Phyci_101052Hypothetical protein

Sequence
3182 bases(100 bases per row)
GAAAGCTGAAGTGTGGATACCTTGCACATTGCCCTGGGCCTGTGCTTCATACCAGTAACTGAGACCAATGTCATAGTATCTCTCTGCAGCGACCGAATCG
GGTCCTTCAATAACCTCCGTTTTGGTCTTCCTGGAAAGGAGCACTGCAGCTTCATATGCCTTCCTTCCTGCGCTAATGAAGTCAACCCAACCGGATCCCT
CTGTCGAAAAATTCTCGGGCGACAGGTAGAACGCAAAACAGTGGATGTCACCGATCAATTTGCACGCTTCAACAGACCCAGAAAGAGCCGAGGAAGACGG
TAGTCCCTTCATCAAATCGGAAGCCCCCTTCAGGTTGGCAGCGGCATTGCCGTACAGCCCTTCGGCGCACAGGTATTTGGCGTGCTGGAAAAGCAGGTCC
GCATAAATCATTGAGGCCACGGTCACATCCGGATTCCCATCCGAGAGTTCGCCAGTGACTACTGGCTTGATGCGCTCTAATGCATCATCAAAAAGCAGCA
AAGACCCCTCAATCCGCGCTAATTCACAACGAACGCACCAACTTTCTTCACCCAATTCGATAGCCTTCAAGTACGATCTCTGCGCAGATACTTGCTTGTC
GAAGTTCTGGTAAATATGCGCTAGGATGACCCAGTAGTGGGCATTCATAGGATCATTACGAAGCACTAGGTGCATTTTTCCCACAGCAGTCTCGTCGTTT
TGTTCCACTAGGTGCTGAGCAAGTCGTAGTAGTGCCCAAGTTGGAGCAATTTCTTGATCCTCAGTCACCCGTTCCCACAGCTTCACATTGGCGTCATACT
TTCCCTGAACGTCGTAAAGGTTGCATAGACTCATTCCCGCTAGTTCATCTGCTGGAGAAATCGAAAGTGCCTTCAAGAAACATTTTTCAGCGCGCAAAAT
ATCATGCGCAACTTCTTCGTACCATTTACCAAGCCAGGAGAAGATTTCAGCATCCGATGGAGTCAGTTTGGCGGCTTGAAGTAGATGGCCAAAGCACCCT
GTTTTGGCTGATTGGTGAGGGTCACCAAGGTGCCAGTACACAATCGCCAATCGCTTGAGTGTTCGCCCCTTACCAACAGCATCAGTGGCCGGAACTTTGT
TTGCATTTGCCTCCAAGAGCGATTGAGCCTGGTGAAGATCACCAAGCTGAAATTGAAGCCATCCGCGCGTACACAACAGTGCAGCATTTACAGCTTCGTC
CTCATCGTTAGATGCAGTAACCGAGTCGATGACTTCTAGAGCCTCCTTCGGTTTCGACTGTGCTGATAACAATTCCGCGGCTGCAATCGCCGCTTTCAGC
GCGAGATTGGCATTTCCGCTCTCCATGACCCCACGGTAGTTCTCCAATGCTTTATCCACATCGCCAGAGTACTCACGCGCTGTTGCTGTCATGAATAATA
CCTTAACCTCCGAATACCTGAATATGGGATTCAAACATGGTTAGGTTTGAGAACCACAGCATTATAACCCTTCACCAATTTGCCTATCTACTTACACAGA
GGGGAGAGGGCCTTCAGATCCAAGTGAGTTCGCCTTGTCAGCCACCACCTTTTTCGCAAGAGCTAAGCGATTCAAGCAGCCTTCTACATCGCGCGTAGCA
AGTGCGATCGAACCTAGTTCAACTTGCACGCGAACACAAAGAGCGCACTCTTGAAATGACGACGAAGAGTACCCTGCAAGAGCTTCAACTAGATTCTCTC
GAGCCTGAAATGCCAGCATTCATGCGTATAACAGTCAGAACGTAGTACGATAACAACCATTTGAGGATAGACTTGCCTGGCTGCTGTCCCCCGTACGTAG
GCACGCGAGTGCTTGATAAATAAGAGCCATTGGGCTCTTAGGATGAGTAGCAGACAACCTCACCGCAATGTCAGTAGCCTTGTCCACGTCAATAGCTATT
ATTTGGCCACAAGCACAGCAGCAGCATCATCAGTACATCTGCTGCCAGCAGGCAATGGGCACACACAGTACTTACGGCTGTCCTGGTCCTCAGCACGGAG
TAGTAAAAACTCCGCCGGGATCTTCGATCCAGGGAACCACTGAATGATTGACGTCGCGAGCTGATCCACTGTCTTGAGGAGGGTAGATTTTTTCTTCGAC
GTCTTCAATGCATCAAGGTGAAAGCGCATGAAGTACGCGATCGCGCCGTCCATCCGTGGGCGAAGTGCATCAAGCTCTTCAGTCTGGACTGTCCAGTCTG
TGCGAGATGCAACAGCAAAGAACTGGCTGGAGAACTCGGCCATTGAGCAGATCCCCGAGCATTCAGATAGACTAAATCCGGGACGCTTTATGATCAACAG
CACAATGGTCTCGTCAGCACCCACATTTCAATCCACAGCTAACCTTTCCCAGCATATGCGACACAGTACCTGGAGCAGGTCAACCAAGTCCAGCCAGATA
TTCAGCGGCGCCGGGAGCTCCTCATTCGGGGTCCTTTCAAGTGAAAGCTGCCCCACATCTCCCGACTGCTCCCCGACCAGCGTGTACCACGCGTCAAAAG
CCTACGCCGTCATCACCGATATCAGAAGGAAGACAACCAAAAGCTTCCTAGCGGCAAGCCAGACACTGCACCTTCGGCAGCATCTTCAGCTGCATCGCGG
TGGTCGCCACCTCCGCCACCCACTTCTGGCAGCGCTTCAGCTTCTTGCCACTGCAACACCAACAGCAACGCCACAAGCACGCCACATCAGCTACAGACCC
AGCAACTTCAATCCCCCGCGCCTGCAGCACCTCAAATTGATCTCCACGAGCTTCTCCAGCGGCCCCAGCTTGCTCTTGGCGTCGTTCCTCGCCTCGAACA
GGTCCACCAGATACTGCAAGCACCGCAAACCTCAGTCTCCAAGCTCAACAACCTCAACCCAGCCTCTGCAGCAGCCTCGTCACCTTCCAGGGCGCCGGCA
TGTCTGGCTTTAAGTCGGCCGCGCGTCGGTACGCCTCCTCGCAGTCCTCCCACTGCAGATAAACCCACATTAGACCAagagagagagagagagagagaga
gCTTGCTATGGACTCGCCTGCTGCAGGTGGAAGCTGGCCAGCCCCACGCACATGAAGGCCTGGAAACTGTTGGGGTCGAACTGCGTCACGCGGCGGCCCG
CGTCCTGCGCCTCCTGATAGCGATCGGCCTTGAGGAAGGCCGCCGCGTCCACCAGCATCTGCCGCAGCATGCTCGCCGACAT