Description :
From Genome Similarity Track
Location :
Scaffold_448:4650- 6028
Sequence
1378 bases(100 bases per row)
CATAATCAGTTCTGCATGACAACGCATCCGACAAAGCGTTATGCTTTAACGGCTTGTGTTATACCTCAAGGTTGTATTCCGCAAAGAATGACAATCAACG
AGCCTTTATTTGTGAGATGAGGGGTGACTGAATCGCAAAGCGTAATGAAGCATGATCAGTAAAGAGCACAAAAGGCTTAGAGCCAAGCTGATGTACTCAA
AAATTGACTCGAGCATACTTCGTGGCATGTAACGTGGCATGTAACTTTTTTTCCATCACTGGATAGTTCTTCTCAGCAGCTTTCAGCGAACGAGACTCAA
AGCGATGACACACTCACGTCCTTCAGCATCTGTTTGTGACGTGTCACTGCCGATGGCAAAATAGAATGCGTCACAGATAACACTAATATGCCTTTCCGGA
TCAGGTAAGACCAAAATAGGGACATGAAAGAGACTCTACATTACGGCCTTGAACGCATCATCTTTCAATGCGACTCCAGCACCAATACGTATCCTTTTTC
AGGAGATTAGACAATGGATGTGTCATCTTAGCGTCATTCGCGCTATACTTGTACAAGTATTTCGCAAGGCTAGTCCAATTACGCAAGTATTTCTGGTTCC
GAGGAACCGGCAAATCTTATATACCTCAACCTTTACAGATTCTGCTCTCAGATCACGCTTTCTATGAAGCACACATGCAGGGGGATCCCGTCAGCACCAA
ATATGCACTTTGAGGCATTAGCGTATAGATTATTGGTGCGCATGCAGTCGAGCAATGACCGCAGATGTTCGATGATCTTTTTCCGCATCTGTCTTCCCAT
GCTCCGCCCGACTATGGACAAAGATGTCATCAAAATAAGTTCATGCGTAACCTCGGTAACGACGGAATAGTTGCGTAAAAAGGCGATTAAACGTTGCCGT
GGCATTAGATAACCCGTGAATTATAACCAGCCACTCCTAACGCATACAACTCGGGGTACTAACCGCGGTGAGCTGAATATTAATCGCCCGCATGATCAAT
TAGTAAGATCCATCGACTAAGTCGTGTGTACTATACATGGTACAACCAACCATGTTGTTCTGGAGGGCGTCCTTTTCTAAGATTTGGCGTTTGCGCTGGA
ATAGTAGCAGCAATAAGCTTATTGTAAGCATGAAAAATGCGCCACTTACCATTCGATTTTTTCACATAGAAGATAGAGTGTGGAGATTTACTCTCGCGCA
CCATACCTGCCGCGTGCTTTGCATGAAAGATGTTATCGATAACATCGCACTGTTACTTAGGAAAGGCAATTGCGTGTAACGCATTATTTGGCTCTAGTAG
CTAGGTTAATTTGATGACGTACACCTCTATCCGGAGGTAAGAATGACGGAGGGTCGTGACACACCACATCTTAATATT