Description :
From Genome Similarity Track
Location :
Scaffold_938:465- 7492
Sequence
7027 bases(100 bases per row)
CCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATTCCCTTCCTACTCTTCTTCAT
AAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCTCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGG
TTCGTCATATCCACGCCAGTACACCAGAAATTCGCGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAAC
TCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCAAAATCCACCCGGTCGGACTCATTCACTGAAAGACGGATCTCAGGCC
TGTGCTGATATTACCTGACCCGTTTCAGCTTGAATACGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTAACGGCGTGTTCCCC
TATCTTTTCGCTCACCCGGAACGGTCCGTGCCATGGATGGGCCAGTTTACGGGCGTACCTTCCTTCACCCGATCTAAATAAAGCCACACCTGCGATCCCA
CTTGGATTTGATGGGGACGAGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGTAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTA
GTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGCAATGGCCGCTTCTAGGGTAGATTTAGGATTCCAC
CCATTTACCAAGTAAAATGGGGTGTCACCCCGGATCCTTTCCTGTGCGATATTCATTGCGGAGGTGAGTCGCTCTGCGTATTCATCCCAATCCCTCTGAC
CCAAGTCTTGAACATACATCTTGAGCGCCTTAGTGATCGTCTGTACCATGCGCTCGGCTGATCCATTGGCTTGGGGACGATATGCCATGGTTGCTCGCTG
TCTTTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCGAATCAACTCACTAGCCCCAAATCTTCGGAAA
ACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAGATCAACAATT
CTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGATAAGTCGCTTGGACATTCCCAGGTGACTCCCATTC
GGTTGTGGGCCTGCCCTTGCCTGTCTGACAATCCACACATTCACCGATATATCGTTGTACGCTCTTGAATATCCCCTCCAGTGGAACCATTCCCGGATCC
GTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAAGTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCAT
CAATCCATCCCGATCCTCGTTGACCCTTTTCGTAGGGGGACAATAGAAGAGCAAATCATTCAGGACTACTGCATAATCCGTAGCGATAATACTGTAGGAT
TTGGCATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGAAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTCTGAGGATCCGCTCGATGCAGACTC
CCTTCACAAACGCTTCCTCTAGGATCTTGGGGCTGGATCCAACCTTTCCTCTGGATCTAGTGACATCCATAGCCTGTACCGTCCGCTTCACGGATCCAGC
CACCATAACTTCGTCTAGTCGGTTTAGTGTGACGAGACCCTGACGCTCGGCCTCTCTCTCCACCTCAACCCCACATTGATTCCGTAAAGCAGCACTGGCC
AAACTATCTGCACTGGCATTCCAATCCCGCTTGACATGCACCAACTCGTGATTCATCCAACCACACAGGTGGACCATCACTTTCTGCCATAACAGTGTTA
GGGCCGGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCCTGTCCCTTTAGTA
GATCCAAACCCAGCAGGAGTCCGCTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCACAAGTGGATCTGGCCCTTACCGCTTCCCATCCGGGCAATTT
CCACAGTATGGCGCTGTATGCTCCTCCTCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTTATCCACTCGTACCGTCGGGATC
GGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCGTCCATCTTGGCTCTAGGTGTGATACTCGCGGCCAAAACTCCCA
GGATCTCGTCCTCCCCCTTCGAACATTTCACAATCTCCAGTGTCCAAGGGGAGGGTAGCGCTGCCCATTGTCCCAACCGTCCTTGTAGACCGGCCGACTT
GAACAGCCAAGCGAGCGTAGAGTGTCGAGTCAAGATCCGGATGGATCTTCCCACCAGCAGGTTATAATTGAGATCCAACATCCGTAGGGGTGCGAATATT
ATCTTCTCCACCGCTCCGTAATGCATCTCATTCGGCTTTAGCGTTCGGCTGACGAAGGTGACCGGATGGCAGATCCCCTCATGTTCTTGTACCAAAGCTG
ACGAGAGCGCCCAATCACTAGCATAGACTATCATCGTAGGGTGACGCTCCGGATCAAAATGGCGGAGGATGGGCGTCGACGCGATCCTGTTCCTTAACCC
CACGAACGCGTGCTGAGCTCGGATCCACCGAGGCCCCACCTTTTTCGAGCTCCCCTCCGTCAGCTTCCTCCAGATTGGACCCTCTCCCCGTTGGTCCCGG
GATGGATCCAGCTCCTGTTTTAGGTAGTCTTCCGGCGTCGTACTACGTGAGTCCCCTCGTGGATCTGGGATCGCTAGGACCAGAGCTTGTTGAATCTTGA
TCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCCCCCTCAACTCATAGAGGACCGCAGCAAAAGTGCATTATCCTCAATGAACCGACTGTAGTAG
TTCGAGCTGCCCAAGAAGGATTGCATCGCCCGGAACGACTGTGAGAAAGCCACGTCTGCCAACGAAGACAGGTCTTTAGGATTCGCCTCCAATACCTCCT
TGGAGACTCGATGACCTAAGTAATTCACCTTGCGCATCCCCCAATAACTCTTCACCACGCTGATAGAGATATTCCACTTCGTACACGCCTCCAGTAGGGA
TGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCTGGATTATGATGCGTTGATATAGGATCTGCGTCCTAACACAGATGGAGTCCTAGAATCCCCTG
GATCTCCTGATTCGAATGGGTCCACTTCCGTATGACCTTCCCCGGATCCATCCCCTTCGGATTCCGGTATTCGGGTAAATCCGTAGAGGGCGTTATCGAT
CAGGCGTTGGTAGATTTGGGGTGCATTCTTCAATCCAAACGGCATCCGGCTCCATTCGAACAGTCCAAATGGTGTGATAAATGCGGATATTGCGCGAGCC
CAATCCGTCATAGTCACCACCCAAAACCCGCTTGCCATATCTAGACAACCGTACCAGAGTACTTTATCCAAATCTTCCAATACCTCATGGATTAGAGGCA
TCGGAAACACCATCAATCTGGTTAGACCGTTAGCCATCCGGTAGTCAATACACAGGCGTATATCCACTCCGTTCTTCTTAACGATGTCCAACACAGGAGA
TGCCCACGCGGACGTTGAGAAACTGATGATTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGCTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCC
TTTGAGCGATCGGCTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGTGCAGCTGGTGGTAATGCATTCCCTTTAACAATTAGCAAACGTCGGCT
TTCCCTGATCTTCTGACGTAGCCGATCCATTTCCGCGGGCTCGTTCGCCCCTGGATCCACTTGGATATCATCAACCGTGACCTCCTCTGTGGTCCGCGGT
ACCTCCAGGATTACCGCCATACCTACTCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCATGGTAGCAGACTTGTTCATCGTCAGTCTTTGTCGGATCCA
CCACTGGATCCAAGCACCGCGACTCCCCTTCTCCCGTCATTTCTTCTGTTTTCATGGGATCGGGAATCCTGGTACCGGGAAAACTACCTTTTGGATCGAC
TTGATCCTCTGGTGAGTTTACCCACGACGGTTCCTGTTTACCCCGGTGCTGACACTCTCGACAAGGATCCAGGCACTCTGTCCAATGAAAAGCTTGGGTC
CAACTGTGGGTCAGCAGGATCCAGCGGACCGGTTTTAATTCCCTGCGATCCCCCATCCACAGACCCTTGGTTACCTAGGGACCGGCTCTGGGTATCACCA
GCGGTCTTGGATCCAGCCTCTACCACTTGGATCCCAATCCGACGATCCCTATGTAGGATCATTCGCGGAGATGGGTATGAAGGCGGATCCACCAAAGGGC
CAGTTGGCTCCGCCGGGAGTTCCGCCTCCCCGAGAGATTCAGGCTCGGTTGTCGCTTCATACGCCAGATTCCGCCATTCTCTATAGCAACGGGACCCCAC
TGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGCCAACCATCGTCCAATCTCCTCATAGTGGTCCAGTAATAGTCTCTTGTCGCTGACATTCGTG
ACTTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACTCTAGGCACCCACTTCTCACCCCGAGTACCCACCGTTTCTCATGTTCTACCCACTTCAACCG
ATGTGGCAGATCACAGGTCTCTCCGGGCTCGATCCAGGTCGTCTTATTCGCCCTTATGATCATCATCGTCGCCCCGTACAACGGTCGTCGTCCACTGAGC
TGGATCCGCATCTCGTCCGGGAAGCACGGTGTCCCATCTGCCAGATCCAACCTTACTCCGGCTGGTATCATGAAATCCATCCCGAGGATGGCGTCTTGAC
CAGCGAGGTCTCCGACCCAAATGTCGAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCATTCGTACGGTACACCCCTTAACC
AATCCCAGCACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAACTTACGAGAAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGG
GTAGGTTCGCTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTC
AGCAGATCCATGGATCCACCATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTGGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAACCC
ATCGACCATGTTGTCGCGTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCG
CAAACTAGTAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTTCTGCTACCTGGATCTAGCGATGTCTTGTTCACA
AATGCATAAATGCAATACCTAGAACGCTCGGCTCGTATTGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCC
TCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCTGACGTCGTGAATCTCGCCACACCCGCGACACACG
TAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTTTTTAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTG
TGAACACCTGATTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTTCTGTC
TTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCG
CCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGC
GCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATTCACGTCTCCCAACGTCTCGATG
AAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCG
GGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGGACTGGGTCTATAACTGCGCAGCAAATCTGGCCAC
TTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTAAGCATCCGACGCTTGGT
CTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGAT
CCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAAC
TCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGAGAGCGCTCTCATACC
CTGTTCGGCCAGGAAACGACTCATCGC