Description :
From Genome Similarity Track
Location :
Scaffold_175:465- 5308
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_175-abinit-gene-0.51Conserved hypothetical protein

Sequence
4843 bases(100 bases per row)
GGCGGCAACACAGGACGAGGCGGTCATGATCGCGTCGCGCGGGTACTTTAGCGCAGACAACGGCCCGCCGCAGCTGCTGCACGCGCTCTACGCCAGCGCT
GCTGTTGCTTCCTCTGGTGCAGAGGCTGCGTTCACGTACCTGGGCGACTCGCGCCGCGAGCAGCTGGCGGACACCAAGGTGGCGGACGAGGTGGAGTTCA
AAGGCATCCGCATCCACGAGTGGGTCATCGGCTCCAACAAGACGCACATCACGCCGCTCGACGACATGGACAAGTAAGTGCGTTGTATGTGTGTGTGTGT
GTGTATGTATGTATGTATGTATGTGTTGCTTGTGGCTTGTGTATTTGCATACTGACTGGGCGCTGGATAGGATTGCGGACGAGGCCAAGCTGACGCCGCC
CGAGATGGTGTTTGGGAAGAACCAGCTGCTCTTCTTCCACGAGCCCACGGGCGTGTGCTACTCGTTCCTGGCTGTGGAAGCGCTCAAGGGCGCGCACTTC
AGCGCCCCCGCGAGCGACCAGGCGGCTGACATTGTCGCTCACCAGCAGCAGCAGCTCAAGGTCTCGATCGCCAAGCACAACACCAACAAGTACGTTATCA
TTGTCGTGTATAGCATATGCGTTATGATGTAATTATGTGCTGGTGCTTACGGCTTGCGTGTGTGTTCTGTATACGAACAGGGAAGACGTGAAGGAGCTGG
ACATCTCGTACGACTGGACGTACACGACCGACTACAAGGGTACGCTGCAGCGACTGACACGCGACGGCCTGCAGTTCTCCCCGAACAGCTCTGCGGGTGA
CGAGGCGAGTGTGAGTGTGGAACCCACGCAGGAGCGCATCGACATGGAGAAGCTCAAAGTGCGCGAGCCGATCCTGTGGTTCGAGGACGTCTCGCTCTAC
GAGGACGAGCTGCACGACCACGGCGCGTCGGCCATGTCCATCAAGATGGTAACGTACAGTACTTGCTGATTGTTATTGGGCTATTCATTGTATCGCTTAT
AACATATAACTTGTGTCTGCTTATAACAGCGCGTGATGCCATCGGGCTTCTACGTGCTCGCGCGGTACTGGATGCGCCTCGACCACGTGGTCGTGCGCCT
CCACGAGACGCGCATCCACCACTTGTTCGGCAGCGACCACTTCATCCGCGAGTACACGCGCAAGGACGAGACGTTCGAGAACCTCTTTGCGCTGGGCCAC
ACGAAGAACATGGCCAACTACACCAACATCGACACGTTCCAGCACCTGCTGCCCGTGCGCGAAGCGCTCTACGAGAAGGTCAGCATCAGCAAGTGAGTCA
TGTGAGCCATGTTCGTGAATTTTTCACGGAAAATGGTGAAAATCGACGTTTAGATTTGAAAACGTGATTTGCTTATTTTCTTGGAACCTGACTACAGCAC
CATTAAATTTTAGTCTACGAGCGACAGTATGCTACATACATAGATTGCTGCGACCTTCAAGCGACATTAAGCAACATCAGTTTGGTTTTTAGTGTACTAC
TGGATGAATATAATGTTGCAGTAGCCACTCTGATTTTGTGCCCAATTTGTCTGTTGAAAACCTAAAATTTACTTATGTGTGACTTTCACTTTGGCGCTCA
TCATCATAATTCAAACAGGGATGGCAGCCGAGGGCAAGCGCCGCGTGCGCTTCCGCGGCGCGCTCTACATCGCGTACGACGCAGAGCAGGCGCCCGTTGT
GCGTCTGTGCGGCGCCCAGCGGCATCTCCGTGTACGTGGTGGTAGTTACACGTCGTCATCGTCACCACCAGCACCAGTAGCAAGGGCGGAGCTGCTCGCG
AGCCTGCGACTGGAGTGCGAGGCGCGCGGCCTCGCTACAGCGGATGCCGACAACGCAGCGGCGCTGCAGCACGCATTGCTGCGTGAATACACAAGAGAGC
TGCGTGGTGCGCTGCAGGAACGCGGGCTCGTAAGCAGTACGCAGACGGCTGACTCTGAGGACGACATTGCGAGCCTCGAGCGGCAGCTCCAGGTCGCTGA
GCTGCTGCAGGCCCAAGTGGCGCTCTCCACCAGTGCGCATATACCATCACAAGAGGATGACTCCAGTGATGCTGGCAGCACTTCTGTCGACGCGCTCGAG
CTCTCCGCCCACGCGCTGACGCGTCTCCAGCTCGCGAAGAAGGACCTTGTCGGCCAGGTCGACGAAGGCTACGCGTTTGGACGGCGGTTCTACTCCGTCG
AGACGTACATCAACACGCTCGAGTTCGAGGAGCTCGTGGAGATCGCGCAGAATCGCGGCCTCGAGGTGCCAGACATCCCTGAGGCAGAGAAGAAGGAGAT
CACGGTCGTCGAGCGCGAGCTGTGTGCCAAGCACTCGACCACGGGTGAGGGCAAGCCGCTCAAGCAGCTCACGCTCCGCGAGCTCATGGTCGAGGCCCAC
GCGCGCGAGCTCATCGTGGTCAACTCGAGAGACAAGAACGGCAAGCGGTCCAAGAAGGGGCTCATCGAGAAGCTACGCGTACGTTGTTGAGCTCTTCGTG
GTTGTTTTGTTGTGAGTGTTGGGCGTAAGTGTACTAAACTGAACTGTGGTATGTCAGCCTGTGATGCGACAAGAGGTGTTGGAGGAGAAGATCCTGGACA
AGCGAGACGATCTGCTGCGGCTCTTGCTGCTCGACGTGTTGGAGAAGGAGGCGGCAGAGGATCAGAGCCAGGCGCTATTGAAGCTGATGCAGCAGCATCT
CAAGAGACTCGAGCAAAAGCAGGATCAACCAGAGAAGGAGGCCGACAGTGCGAACCAGTTGGTGAGCTCTTCCTGTCCAGACGAAGCGATGGGTGCCGAT
GAAAGCAGCAGCACGCCTGTTGGAGATGCTGCTATGGGAACGGCTGACGACACGAAACGTCAACTGCAGCACTACTTCTCCTTGCTCACTCGCCTGCAAG
CTTCGACAGCCGCTCATCCAGAAGTCTAAGTACGTACATGGTCGTTACAAGATATGTAAATACGCGATAAGGTATGTAAGTCAGACTTGAACAATCGAAG
CGTTCTTGGAAAGGACTGTCGGCTCTTTTGTAGCTCTCGCCCCGCTGCAGATTAGATCTACGAACCAAACGCCAGCCAAATCACTAGGTGAGGGGACAAT
CTACAGGGCGTGTTTCATATCGAAGCGCCAAGGCCCAAGAGGCATCGCTAGCTGCGCGTTCCTACACCCAAGGTAGGCTCATCATCAATATATCTAAACT
GACACTGAACTACGTGTGATGGCGCGTCAGGTTCAAGACTTGCTGGACACAAATAGCCTCACAAGTCGCCAACGACTCGTGTCCATTTTCAGCCTCCGCG
TGCTGAGGAAATAGACACAAACACGAGCGAAACGGTGTCACGCGCGGCAAGAAGACAGAGAGAGCCGAGTCACCTGGAGCACTCGCGCTGCGTCTTCGTA
CTGCCTGCTTCGCGGTCTTGAGTGACTGTAAAGCGAGAAGGCAAGCCCTGCAAGTGTGAGCTACGAGAGAGCGATCAGTCGAGAACAGTGGACATCCAGG
CGTACTGCGAAAAGGAATGAACGACAAACCGAATCAACCTTTACAGTGTTGATACAAACAAGTACCCAGTCGCCAAGATCATCAGAGCCTCGCGAATGAC
AACGTCGCGCATTACGTCTACGAAAAGCATGTTTTCTCTTCAGCGGAAGCAGTCGATGACCCAGACGACGTCCGCGCAACCAGCACTGTCTTCGCCGCCG
CCACTGGCACCAGCAGCGTCGAGCAGCAAGGCATCATTCTCGATCCACAATCCACTCGCGATTTTCACGTCACCGCCGTCGACAGCTTCCGATATTTCGT
CGCCCGTGAACGAGGACAAGGCTGATGACTCACCCACGTGTCGATCGGGCAGCAACAACGAGAAGAAAGTGTCGAACAGGCGTCCATCGGCTCAGCAAAC
AAGCCAAGGCTCACATTTGCATGAAGAGAAGAACACAGTGTCCAGCCCTCGCTCGTCCACGCTCAAGGTTTGATTGGCATATCTCTAATAAGGTTCGGGT
ACTTTGTGATTCTCGGCGACTGACGTGGTTGCTTGGTCGTTATGTTGCTCGTCGTTGGCTAGGTCGACCTAACGCTAACGAGCACCGCAAATCTCGACGC
AGACGGAACGGTGCGGCATAACCTCGGTATGCTCAAGAGCATCCGATCGCTGCACGTGGACCCACTGCACCACAGTCGCACGGTCGCTCGGGACTTTTCG
CTGCCGCCGATCCCCATGTCGTCGCTTCTGCACGAAAACTGCTCGAGTCTCAAGGACCAGTTCCTCAAGATCAAGGAGCGCTTCTCAGCGCCAAGTCCAA
CTGCTGCAGCAAAGCCCTCGCCTAAAGTAGCTGACCTCCAGATGATTCCGCCGGCTGGTGGTGGTGTTGCACAGTCCGACAGCGCAAAGCTCGATATTGC
GTTAGAGGACGAAGAGAAGGCGCTGAAAGCGAGCGAGTCGATGGAGTTGACGTCTGAGAAGGCAGCCACCAGTACCAGCAGCACTTTGGATCCAGACTCG
AAAAGTTCGCAGCAACCAGCAGAAAAGACGAATAAGCAAGACGTGACCAAGTCACCCTCGGGCAAAGTTAGCAAGTGGCCACAGCAGACCCAGGTGGAGC
GCTGGTACGTCGAAGACAACTTCTTCAAGGGCTCAATCACATGTTGGACGATGGACAAAGGCGCCGAGATTGTGAGCCGAGTCGCCGCCGTGGTCTCCAG
CAGCCCCGAGTCTTCCCTGCTGCGCATCAACCCCGACATTTCGCTGCAGTGGATCGGGCGGCAGCTCTGGGCGATTACAGTCTCGCTCCCTCTCACTCGC
TCCGGGGAGCTCAAGGACGAGCACCGTGGGCTCGCGCGTCGCA