Description :
From Genome Similarity Track
Location :
Scaffold_792:465- 2294
Transcript NameFunction/comments
g16335.t1hypothetical protein

Sequence
1829 bases(100 bases per row)
AGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGGTTTGTGACTAGCACCGATGGTGCGACTTCGCCAATCAATCCATGGCTCATGTTTAGTA
AGCCAAGGCATGCCTAGGATAAGATCGTATCGATCATCCATGTCGAGGACAATGAACGGTTCGACCGAATTGAAGTCGTCAAACTTGACGTTTAGAGATA
GTAGAACCTTCCGTGTAGACACGATGGATCCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTAGCATACAATGCACT
GTTCCTAGCCACACTGGACTTCGTCGCGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTAACGCTGGCTGCGACA
ACCACGAGGTTGGACCGCGCGGCGGCCACGGAGAGACACAGAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCAGAGCTACCGACCTCG
AGGAGGAGCGATGTCTCTCAGCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGTGACGGAGCGGCCTTG
CCGCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGCGTTGATTGCGCTGGG
GACGAGCCGACTCGGCCGACGAGATCTCCATAGGAGTGGGATCTTCCGTCGCCTCTGCGCGACCCGCGTAACCCTGCGCCGAGCGCACGCAATGATCTTT
CAGCATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGGCCCGGACGGACGCCATCCATGAAGACCGTC
ACCTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCCTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGCGTGCGCGTTCCTTGCTTGCACC
GCAAAAAGAGTGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAAATACCCCGGAGA
CGAAGTCTCTCGTGCCATCGCCCATGCGCGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACTCGTAGATCTGCCCAGCGCTC
AGCGCTATCTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTGCCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCCTTGCC
GTGCGGCGTACGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGCGCCTCAGCTCGCATCGTCGTGCGAGCAGCTTCCTGTGCTGCAGCACTCAC
GTGAGCAATCAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGAAGGTTGGGGAATCCAGCAAACGCTGCTTCGCCC
AGGAGACTGACCATCTTTTCCAGTGTAGCCCAGTGGGCATCTGAAAGATGAGGAAAGTCCTGCCGGGACGGCAGCCTGCTCTCTGAGTCTTCCATACTCA
GAGAGATCTTGATTGTAGCGATCCGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCACCTTAGCCTTAGAGGAAGCG
TTAACGCGCTAACCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGAGTACCAAACGACTTGCGAACTTCCAGG
TTAGAGTTAAACTGTCTGTATTAATCTCA