Description :
From Genome Similarity Track
Location :
contig_74:465- 2188
Transcript NameFunction/comments
g11819.t1hypothetical protein

Sequence
1723 bases(100 bases per row)
GGTGGGCAGCACATTCGCGGGATTCGGGGGCCGGCGGCCCGTGCGCACGCGGCGGAGTTCGGGGGGCCGGCGCCGCGGCAGCTGCGGCTGCTGCGGGCGT
CCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGGGTCGTGGCGGCGGCTGCCGGCAGCGGCGCGGTCGT
CCGGCGCGTCCTCGTCGTCGCTTGAGCCGTCATCCGGGCTCGCTGGGGCCGTACGCGGCCGCGAGGGCGCGAGCCGTGGCGGCTGCAAGCGCCCCCAGGC
ACGACCGGCACGGGCAGCATGCCGCTCGCCCTGCCGGGTCGTGCCACATCACAGGGGAGCTGGGCGCGGGCGACGGGCGGAGAGGCGGGCGAGGGACCTT
GGCCAGCCAACGGGCGCGCGTGGGGGGCCGGCGGACGTCTGGGACCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACGGGCTG
AGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCCCGCCC
GCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGC
CGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCC
GCAGCGCTCTCCGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGT
CCACTGCGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTC
GGTGGACAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGGACAATGGAGGACGCAACGCGGACC
GAGGTGGACAGCCGAGGAGGAAAAAGATAGAAAAGAGTCAAATGTAGTTGGCCTCGCGGGGGAGAGGTGAAAGCCCCCGGAAACCGCCCCGTCCTCGCAC
AGCAAGCTGCGCGACAACGGGATGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAACAGAAAAGTTA
TGTGTATTACCGACCGGTTAATCCTTGGCTTCCAGGTAGTAAATACCTGGTAGTCGCTATGTGGTGTGTAACTTGTGTACAGGTTGCACCTCATAGGTGT
CGGACCATAATGTACCGGCGGGGTTTGAGGGCGGTTCCCTACCTGGGTGTGGCCCTGTCGGCCGCTGTGGGCCTGTGTGCCGTCTAGCGGCGGCCGGTGC
GCGGCGGAGTCCCCCGGTCTCCGCCGCCCGACTTCCCCCTGGTGCTTGGTGCTGGCGCGCGCGGTGCTGGCTGCAGTGCAGGTTCCAGATGCGGCGGCTG
GACTGGATGCACGCCACCGAGAGCTGCCGGTCCAGCCGCTTCGCATCACGCTTGAGCAACCCAAGGTGCTCAGTAAGCACCTTGTGGTTGCCGGCCGGCA
CCGCGCCGAGCGAGCCGTACACG