Description :
From Genome Similarity Track
Location :
Scaffold_2861:465- 2096
Transcript NameFunction/comments
Phyag_g12857hypothetical protein

Sequence
1631 bases(100 bases per row)
CCTCCCCCACTCAAGGTAGAGACCTCTCCCACTAGCGACGCCGGCACTCTCGGATGGAGACCGTAGTTCACAAAGAATGGGGAGTGACCCGTCGAGACAT
GCGTGGAGTTGTTCAACGCAAACTCGCAAAGAGGGAGAAACTCGCTCCACTCTTTGAATGACGTAGCGTAACTACGCAATACGTCCTCAAGGACACGATT
CACTCGCTCTGTTTGACCGTCCGTTTCGGGGTGTGCCGCTGTTGACATAGACAACTTGGTGTCCAAGAGTCCAAACAGTGCACGCCAGAACTTTGCAGTG
AAACGGGTGTCACGGTCTGACACGATCTCAACTGGAAGGCCATGCAGACGGAACACGACGTCTACAAATACCTTGGCAGTCTTCTCTGCTGAGATCTTGT
CCGAAACAGGTGTAAGATGAACCATCTTGCTGAATCGGTCCACAAACACAAGGATGCCGTTGCGTCCGTGTTTGTCTCGCGGAAGTCCGAATACGAAATC
CATACTCACGGACCTCCAACTGTCCTGGGGGACAGGCAAAGAACGAAGTGGGGCTTGGGTGGNGAAGTACTTGAATAAGTCCTGACAGATCTCGTCGGAC
TTGTAACCCCCGATAATATCTTCACGCACTGTAGTCGATACTTGAACAGCGATCGCTTGAACATCTTCACAGAGTCGACACGCTTCGACCGGATCCTCGT
TCTTGGATTTGGGATCGTAATCCGGACGTCTTGACAAAGCGTCGGCTAAGATGTTCATCTTGCCTGGCTTATAGTGAACAANAAAGTTGTACTCCGCAAA
GAAGGAGAGCCACCTCGCCATTCTCTGCGACAAGTGAGGAGTCTTCACCGCTGTCCGCAGCGACGCATGATCAGTATAGATCGCGAAGCGCTCCTCTCCA
AGCAAGTAAACACGGAACTTGACTAAGGCAAACTTCATCGCAAGAAGTTCCTTATCATGAACTGGGTAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGACT
GGTACGATATAACTCGCTCTCGACCCTCATCATCGTGTTGCATCAACGCGCAACCAATGGCATAATCGCTCGCATCACAGACGACGTGGAACGGCTTGTC
GTGGTCCGGAAGAGCCAGCACAGGAGCTTCACGCAGACTCCGCTTGACCTCTTCGAACGCCGCTTGGTGATCTCTTGACCACTTCCACTCAACGTCTTTC
TTCAGCAGTTGTGTCAGAGGCTGCACTAACGCTGCATAATTGCGCGTGTACTTGTGCAAGTAATTTGCCAGACCCAACCACTGCCGCAACTGCTTGACAT
TCTGAGGCACAGGCCAATCGTCAATAGCTTTGACCTTCTCCGGATCGATGCGAATACCGTTCTTGCCCACAAAGCAACCAAGAACAGGAATCTCGGGGGC
AAAGAATAGGCACTTTTTCAAGTTTGCGTAGAGTTTGTTCTCTCGCATGACCTGGAATACTTGACGTAGATGATCGAGATGAACACCAGACTTTCCATTG
ACGGCCTTACTATGAACGAATATATCGTCAAAGTAACTTGGTGCAAACGTTCGCAAAGGACGAAGGATGTTTGTGACCATGCGATTGAAAGTCGCAGGCG
CATTCTTCAGTCCTTGTGGCGTCACTAACCA