Description :
From Genome Similarity Track
Location :
contig_20:464923- 466186
Transcript NameFunction/comments
g4243.t1hypothetical protein PPTG_12493

Sequence
1263 bases(100 bases per row)
TTCCAGAGCGGGTGGTCGACGGCGCAGATGAATCTGGCGCAGTACAACGACACGGACGCGTGCAATGCTCGACCGTGGTGAAGACACGTGCCTCATGTTC
CCCGGCCATTCTAAGCTCGAGTGGACGTTCGCCGTGAACGCCTGGATCTTCGGCGCCATGCTCGGCTCTCTGTGCTGCGGCCACTTCAGTGACAAGTACG
GCCGGAAGAAGGCTCTCATGGGCAACTGCGCCTTCATGCTCCTCGGTGGGGTCGTGCAGGCTTCGGTGTCCAACATCTGGGCGTTCGCCGTCGGTCGGTT
GATCTCCGGCTTGGCGTCTGGAACCGCACGGGGACCATCGGGGCCTACGTGAACGAGTTGTCTCCTCCGCCCATGCGCAACACGTTGGGTCTGGGTCTCC
AGATCTTCACGACGCTCGGGATTCTAGTTCCTGCGATCTGCTTCTTCTTCGCCAACACGAGCAGTGGCTGGCGATACCTTGCCGCCTTCCCGTGCGTCTT
GGCCGTGCTGTACCTGGTTCTAGCGCCGACACTGTCAATCGAGAGTCCGGCGTGGCTGCTCACGAAAGGGCGAGCGCAGGAGGCGAGAGAGGTGATCGCT
AGTTTGTACGGCGAAGAGCATGTGAGCACGGCCATGTCGTGGCTGGAAGTGAGCAAACCGCACGCTGACGACGACTCCACCTCGACGGAATCCATGTTCG
CCCCACGCTACCGCATGCAGCTGCTCGGAGGAGTGCTGCTCTCCTGTGCACAGCAGTTGTCGGGCATCAACGCCGTGTTCTACTACTCGGGCAGCATCTT
CTCGGACGCCGGCATCTCGGACTCGCGCGTCGGCACGCTCATCATCAACTTCATCAATATCTGGCCGGCCTTCTTCACGGGCGTGCTGGCCAACCGCTTC
GGAGCGCGCAACATGATCCTCTGGGGACTAGCGGGCACGGTCGTGATGGCCGTGGGCATGACGGCGTCCTTCATCGCGGATCTGCCGGCGCTGTCGGTCG
TCTTCACTGCGCTGTACGTCATCGCGTTCGGCGTGACGCTGGGGCCGCTGGTGTGGGTCATGACGGCCGACATGTTCCCCGACTCGATCCGCGCGAGTGC
CTCGTCGCTCTGCATCGGCGTCAACTGGCTGTGCAACCTGGTCGTGGGCGTGGCCTATCCCTACATCTCGGACGCGCTCGAGGACTACGCGTACGTGCCG
TTCGTGGTGCTGCTCGCCATCTTCTACCTGCTGTCGCTGAAGCTCGTGCCGGAGACGTCGGGC