Description :
From Genome Similarity Track
Location :
Scaffold_357:4649- 13528
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_357-snap-gene-0.5Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_357-snap-gene-0.6Cytochrome P450
Pytve_DAOMBR484maker-pve_contig_357-snap-gene-0.9Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_357-fgenesh-gene-0.1U3 small nucleolar RNA-associated protein

Sequence
8879 bases(100 bases per row)
GTGGCAGTGTCTCCACGTGAATTCAGAAAGCGAACCAACGCGACAGTGACAGGACTGACTGCCATCTTGTCAAAGTTCGCTTGACCACCCGCTTGCGAAC
GCATCGACTGATACGCAGCGACACTGGCGAAAGGATCAACGGAGACCACTTGCACCAGCTCTTCCAAGAAGTGCGCACCTTGCTTCCCACTGTTGTGCAA
ACTCTGCAACCAAAATCTGATCTCTTCGTTCTCGTCGATGCCTTGCTCGCCAGGTTGACCAAACACACCGGAGATCCACAGTACGCGAGTCAGCACCTGG
TCGCACAGGTCACGAATCATTCGGCTCTGTGTGTTCACATCTAACAGCAAGAGCAGCAGCAGCTTCGACGGAGTTGGCGCAACGCTCGAGCCTCCTCGTT
GCAGAAGAAACCGAAGACGACTGGTATCCACCGCCAGCAGGAAGCGCAGCATCTCGGCAACAATCATGCTCTGCAACGACGGACGTCCGTTTGAGTTGTG
TGTCAGCGCTGACTGGTGCTTGTCATCATCCTCCAAGTACTGCCACGCCAGCAACTTGGTGAAGTCGAGCTTCACCTCGCTCATCATTTGCGGGAAACAC
TCGAGGTACAGTCGGAAGACGGAGAGCGCGCGAATGTAGATGAGCGCAACAGGCTGAGTCGACGAGCACAGCTTCAACAGCAATGACACAAGCGCCTCGG
GACTTGGCAGCAAGAACCGCATCTCATTCTCCAGCTCCGTCTTGACGCGATCAGACTGCGTTGACAGAATCACGTGCTCAAAGCGATGCAGAATCGACTC
GATGACGCCGAGCGAGGAGTACACAACCAGGTCATTCACGTGCTGGATGCCGCGCGACAGTTCTTTCCGGAAATTGCAAGGCGCGATGAGTCGCGTCGCA
AGGAGTTGCGGCGTGCACCAAACAGATTCGGCCATGTCATCCGGCAGACCACTGGCCGCAAGAGAGCACGAGAGGAGCTTCTGCACGAGCGAGGCCACGC
AAAACCATCGATACGCGGCGCGTGGCTCCAACTGGATCGCCAACGCACTCAAGTAGTCTGCTGTAGCAGCCGGGTACGTCGTGAGCAACTTGGTCACGAC
AGCCTGGGCGTGCGAGCTCCGCATCAATTCATTCACACCGACCCCCACAAGCGTGTTCCGGATGACTTTCGTCGCGTTGACTTGGTCGAACGATGTGCCG
GTCGATGGCGTCGAGGCTTTGGAGAGGAACAAACGACACGCGGTTTCCGTCGCGACACCGTACAGAGCGTCGTCTCCGAAGAAAAGACGATCCAGCATCT
GAGCGGCCAAGGCAGCCACAGGCTCTTCCTCCGACTGCAGCAGCGGCAGCAGCAACAGGATGTTCGGTCCGCTGAAGATGACAGTCTTTGCGCGATGATC
CAAGCTCGGGTTCCTCAGCACGAGCTCCTCCAGCTTCGAGAACAGCAGCGTCAGTAGCTCAGGCGAGTCAGCTTCGATGCTTTTGAACAGCGAGACGGCG
ATGCCACCCTCTTTCAGCGCGAACCGACGGACGCTTGTGTCAGGACACGCCATCAGCTCCAGCACCAGACGCACGTACGCCTCACGGATCTGAAACGCTG
GTGCTTGCGGTCGAGCCTTCTCTTGGCCCTCATCTTCCTCTGTATCGGCGTTGTCGCCCACTGGCTCGGGTTTCTTCATGCGGCGTGCCGCCATCTTGAC
GAACACGGGACTCTGCAGGTGGAACAGCCGCACGAACTCGCGCGCCACGACTCCGTTCACCGCGACCAGCGCGCGGCACAGCTCGAGCGCGCGGAACTCG
ATGATCGGCTTGTCGCTCCACGTCATCACCTTCTCGACCAGCGCGCTCTTGTCGCGGATGACCTTGAGCGCCAGCGCCTCGGCCGCCTTCGCATCGCGAC
CAGTCTGCGCCGTCACAAGCGCCGCGAGCACCTCGAGGAAGACAGCCACGCTCTCGCGCTGCTCCCATCGCGTGCCGGCGCCGACAGTCTCGGGCCAGCA
GCGCAGCAGCGGTTCGCACTGCGGGTGGATGGCGAGGAAGCGCTCAGCCGAGGATGGAGTGGCCAATGCTGGCGCCAAGCTGCGGATCGCGGCGTCCAGC
GGCTGCTTGGCGTGCTCCACGGTCAGCAGGAACTCGCGCAGCACGGCTGCGGACTCCGCGTCCGCCATTGTGACGGTGGTTGGGATGCTGGGGCTGGTGC
TATCGAGCGCGAGCAGCCACACCAGCGTCAATGGCTTCGCGCCGCTTGCTGGTCTGCAAAGCGCTGGCCTGGAAGCAGGGTTACGAGTATAACCAGTTGC
GAGTTACTCATTTGGGCCCTCCTGTGACGTGTGAGTAACCAGGGTAGTACCCTGGATATGGGCATAACCTCCTTCACAGTGCGAAAATGAATGCGCCAAG
CGGTGCCGACGGTGGTGCAGCGGCGCCGCGAGGCGTGCTCGCTGGCTTCGTGTCGACTGCCGTGCTCACCTCGTCGGACGGGGTACGTTCTTCGCTTGCA
ATCGGTGCAGTCACCTGAGTGATCGGCGCGATGTGAGCTGCACAATTACGCGTGAACACTGACGCTGTCCCCCGCAGCTCTTTGGCGACAATGTCGAGGA
GAAGCGCATCTCGGAGGCGCCGGCGACGCGCGCGCAGGACTCGGCGGGCTACAAGCCGCTGTTCGAGCAGCTGCAGGATATGAAGGAGCGGAAGGATAGC
GAGTGGAAGGAGAAGAACAACCCGTTCGGTGCGTTGGTTGGATCGTTGTCGCTTGGTGGGTATGATCCTGACTGGTGACCGCCGATCGCAAGTGTAGCGC
CGCCCAAGGCGCTCGATGAGGAGGAGATCGCGTTCATCCGGGACCTCGAGGATCGCCAGGCCGACACGGAGCGGCGGAGACAGACGCAGCACGAAGAGGA
CGTCGCCAATTTTTGTATGTCTTCCCAGTTTGTTATCTGTCGATCCGAGTCGGTCTTTACAGCTCACGGCTCCATGTTGACTGTGCAGTGCTCGCTCGAG
AAGGCGCCAAGCAGACCACGGGTTCCGCTCCTCCTGTCGCCACGGTGGCGTCGTTGGCTCAGTCGCAGCCGCGGGAGAAGGCCGCAGTGTCCAAGAAGGC
AGCGCCGAGCGTTGTGGTGGTGCGAGCAAAGCGGAAGGCGACCCAGGCAGGGACAAAGGCCAAGAAGGCCAAGAAAGGAACCGAGATGACGGCTTCATCT
GCCGCCAAGTCGGAGGTGAAGGCGGAGAGCGACGAGAAGGTCGCGGTGGCTGCACCGTCACTGGGTTTAGTGGCCTATGGGAGCGACAGCGATAGTGACT
AGAACCAATGGATCCCTTATGCACCACTTGCCAGTCCCTGGAGATTGGCTCCACCGAGAGTTACAAGTGAGAGGAGCTGAACTTTTCAGTGCCGCAGCTG
ATCGCTCACCGAGAGGACGCTCTGCTATCCTGCCCTGTCAAATATTGTCTCTGCTGCCCGAATGGCTACAGAAGATCATCCTCACATCACCACCAACGAT
CTCAGCCCTGCGGCAGCTGGTCGGTCCCACACCTTCAACGAAGAGGCGTCGAGCCTCCAGATTCGCAGCAAGCGCATCATGGTGTTCCTCCTCACCGGTG
ATATCCGACTGGACTTCACCCATGGACCAAACTCGAATTACGTGTGGTGCGGCACCATCTTCCACCCATTGGCACTGCCACATTGGTGCTACTTTGGTGG
CCACGGACTCTACGTCGAAGTCAGCGCAGTCATTTCGGTTTTCTCCGATCGCGGAAAACAACAACAGCCGCCTTTGCATCACCTCCGCCATGCTGCAGCT
GCTGGTGTCGACTGAAGCGACCCCATCGACGGTCCTTGTGGTCGCTGTAGCTGTCGCTGGCGTAGCAGCTCTGCTGGTGCGAGCGCAGCCACTATTCCTC
GATCCGCGTGCTCAAGTATCGCCAGTGCCATCATCTTTCGACACTTTGCACAAGGATCGAGCCAGCGCACCCGTCGTCCGACCATCCACGACGCTGCCGG
TGGTCGGCGACCTCTTGCACCTCGCGCGTCACGCCAACCGCGGACACGACTGGTTCCTGGAACTGCAACGGGAGTCCGGCGGCAAGCCCGTGCTGCTGAA
GCTGCCTGGCAAACCGGATCTGCTGCTGATCGCGACACCCGAGTTGTTCGAGGCCATGCAGAAGGACCAGCTCGAGTCGTTCGCCAAGGGTGAGAACTTC
CACGACCTGCTCGTCGACCTGCTCGGCGACTCGATCTTCATCGTCAATGGGGTTAAGTGGAAGCGACAGCGCCAGTTCCTCGCGCGATTGTTCACAGCCC
GCACGCTGAGATACCACGTCGCGCCGATCGTTCAAAAGCACACGCACACCCTCCTCGATCTGCTCGGTTCGGCCGCCGAGGCAAGGCAGGTGGTCGATGT
GACGGAGATCATGCACCGGTTCGCGCTCGAGGCGTTCGTCGAGTTGGCCATGGGCGTTGAGCTCGGTCAGCTCTCGGCTCGCGCTCAGCACCCGTTCCAG
GCAGCGTTTGACACAGCACAGCTCGTGATCGCTCGCCGCTTCTCGGTTCCCACCTTCGTGTGGAAGCTCAAGCGATGGCTCAACGTTGGCAGCGAGCGCA
GGCTGCGCGAGAGCCTCGAAGTCGTCAACACCATGGCGCTCGACCTGATAAACCAGTCGATGGAGCAGCGAAAGCACCAGTCGGACGATCGAGCCAAGCA
CCTCGTGGACCAGATCTTGGAGATGGCCGAGACTGACCAGCTGGAAGTCCATCCTACCGAAGTGAGAGATATCATGGTCGCCACCATGGTCGCCGGTCGC
GACACGACGGCCGACACCATGAGCTGGTTCTTCCATGTGTTGAGCCACGAACCTCAGGCGGTGGCGGCCATCCGAGCCGAACTCCTCGAGAATGTACCGC
AGCTGGCGACGGACCCGACGTTCGTGCCGGCCATGGACGACATCCAACACCTTCCGATCCTCGAGGCCACGATCCGCGAGGTCATGCGGCTGTTCCCGGC
TGGTGCCTTCACCGTCAAGCACTGCATACAGGACGCGTGGTTGCCCGACGGCACATTCGTGCGCGCCGGTACTGACGTGGGGGTCGCCGTCTACGCCTTG
CATCGCCTCGAGAGCGTCTGGGGAGACGACGCGGCGCAGTTCAAGCCCGAGCGATTCTTGGACGATTCGACTGGCAAGCTGCGCTCCTTCTCGCCGTTCC
AGCTCGCGACCTTCAGCGCCGGTCCGCGCTCGTGCGTTGGTAAGGCGCTCGCAATGCTGCAGCTCAAGATGGTCTTGGCCACCGTGCTGTTCCACTTTGA
CCTGGTAGAGGAACCTGGCCAAGAAGTCGTCTACACAGCGGGCATCACGCTAACCATGAAGAACCCGCTGCTGATGCGACCTCGGCGGACCGTCGCCATC
GGAGCATAACTAAAACTGCATGAGCATCCAAGTTCAGATCATGCTAGCTTGAAAGAAAAGCGATGACACATTACCCACATGAGCAGATCTAATGTATTCA
CTTGAATAATGGGGACGGCGGTGTTTGCCGTGGGGGGCGACCGGGTCCTCGAAGCAGCGGACGGTGAGCACCGGTCGGTTTTCGGAGGGGTGGCGACGCC
GCGACCAGCACACGCTCTGATCTACGCGCAGGCTGGCGCTTGGGTCGTTCAGGCGTCCGCATCACTATTGCAGATGGCGCTGTTGGCAGACGTCCTGCGG
GTGCCGCAGCTGCGTTGGCTGGTCGAGTGCCGCCACCAGGTGGAGCGACGACATTTCGAAAGGCAGATCCGTGGCGATTCTGCAATGCAGGGGTCCCGCC
GGTCGACCTCAAGACTGGATTTCCTAGCAATAGCGAAGTCTGAGTGCGAGAACTGGTCGAGCGAGGCCGATCAAATGTCGACAATGATCTGGACTCCACC
GCGCGGGCGGAAAGCGAGCCTTGAGCTGGAGGTTGATGCACACTCTTCGTGGAGGAGGCTTTCGGGGCCATGTCCTTCGACCTTGGTCGTTTCTCCTTCC
GACCCCGGTCAGAGTCTTTGGCTGAGTCACGTGGTGCAGTGCTGCCGCTGCTGTGGGACTCTCGTGCGCTCCTGGTCGTGGACCGCCGAGACTTGTGGTG
ACGGGGCTTGTGCTGTCGCTGGAGCTGTTGCGGCAGCAGCATCTCCTTGAATGTGTCGGACATCTGTGGCAGCAAAGTGGCAGCATTCAAATGAGTGACG
GGTTGGATGCTGGCTGCGAAACTAGCAATCGGACCCACCTCTGAACGAACGCGCTTTAACGGTCGCTCATCACGTAATGCCGACAAGATGCTGCGCTTGG
TTGACGTATCCGCAGGTCCGTTTCCACCATCAGCCGATGAAATCGAGGTGCCACCGTCATTTGCCTGATTGCCAATGGACGCGATCGAATTGTCAGGTGT
GATGGCGAATGTACAATCAACGGCAATGAGAACGATCCAGTCTAGAACGTACCGGCGACGAGCGATGTCCAGACGGTATCCCAGACATCACCGTACCGGC
AATTGCGGTCGAAGTGGCAGCGTTGTTGTTGACTGGCGGTTCATCGTCTCCCAGCTCGTACACCTTGAACAAGTACCGGAAGAGCGCGGGAAGCAGCTTC
TCCAACCGCGGAGCTAGCTCGCGACTCAGCAGATCTTGAAACGGCGAGTGTTCTCCTTCGTCTATCAGCGACGGCGGATTGCCCGCATCCAACAGCAGCG
CGATTCGATCCAACACCCCGCGGATCTCCTTCCTCGCCGCCTTCTTGGCATCCTTGCTCTTCGAACCGCTGTACGCAAGCACGCGAGCAACTAGCTGGAG
CTGAAGCGACCCGACCCTGGCCGCACGCGGAAGGTCCCGAGCCTGCGCAGCCGAGGAGACAGCCACCTGCGCTGCACACGTCGCGAGCGACCTGCCAATG
CGTCGGAGCTGTGCCTTGTTGCCATCAGCCGTTTCTAGCGCACGATCCAGGAAGCTCCCCACAGGCGCAGACAGAACAAGCGGTGCGCCATCGGAGGTGG
CGGCAACGTCGCTTCCCGCCGCATGGATCTCAGCAAGTGCCGCCTCGAATTCGCGTCGCCAGTCGAGCGGCTCAACTGCTTCGGTCTCTCCGTCCATCTT
GAGATGCAAAATAGCTGGTCCAAATGTGCGCGCCAAAAAACTGCCAACCAGACTTTGACGTCCAGATAAATATACCCTGTTTGGATGATTCGATTGAGAA
AAGACGCCATTTATTTGGGGACACAAATTGGCGGGAACACCTTGCACAAGGTCATTTTTGGAGCGGAAAGATGAGCGACGAGTACTCAGCGGACGAGGGC
GGCGCGGCGCCGGCGCCGGAGCTGGCGCTGCAGCTGCGCAACTCGAAGCACCTGAAGCAGGTGGGTGTGGCTGTGCGTCGGCCGCGGCTGCGCGCGTCCG
GCGTCAAGGGCCGCGCGGACGAGGACCGCAAGAACTGGGAGCTCACGCTCTTCGAGTTCTCCGACTCGAGCGAGTTCGCCAACCTCGAGACGCTGCTGGT
GCAGCTCGCGCCGTCCAAGTGCTTTCTGTCATCTGAGCTGGAGCAGGGCGGGCAGCAAATCGGTGCGTTCCCTTACCATGCTGGTCGTTCAGGTGGCTGT
CGCGACTAACTGGGAGATCTACAGGCGACAGCAAGAAGCTGCACGCGCTGCTCAAGGGTCACAACGTGGCCAACGTCTACATTAAGAAACATGCGTTCAA
GGACACTGGGCTAGAGACCAATCTCGCCCGGCTGCTTGGCGCGCCGGCCATGACCGAGTTCAAGGGAGTGCTCGACCTGCAGCTCGCGACCGGCGCGCTC
GCGTGCCTCGTCGATTCGCTCGGGCTCATGGCGGATGCGGACGGCTTCGGCAGCTACACGCTGACGGAGGGCAGCTTGTCGTCGGCGATGCAGCTCGACA
GCGCGGCCATCTGGTCGCTGAACCTCCTTCCGGATCCGAAGGCAAAGGGCTCGGCGCGGTTCGGAGGCAGCGTGCTGGAGATCCTGAACCGCGGGAAGAC
GACAATGGGTCGTCGCCTGCTGGAGCGATGGATCCGCCAGCCTCTTGTGGACATCGATGCCATTACAGCTCGACAGGACGTCGTGCAGGTCTTTGTCGAC
GAGGCGTCGCTCCGCATGGAGCTGCTGGATGAGTGCATGAAGTCGCTGCCAGATCTCGAGCGCCTGAGCGTGAGTCTCGAGAGGAAGAAGAACGCCAAGA
TCACCGACCTTGTGAACGTGTACGACGCGGCCAAGGACGCCATCCCTCGCATCCGCACGCTGCTACAGGACTACGACGGCGAGTCGAGCGAGTTGCTGCA
TGCCAAGTATGTGACGCCGCTGAACAAGGTGGTCGCGGACATGCAGGGGTTCATGGAGCTTGTCGAAGAAGTGGTGGATCTGGACAGCCGTCCGACGCTT
ATCGTGAACGCCAAGCACGACGAGGAGTTACAGACGCTGCGCAACGAGTGGAACGACGTGCTGGCTGACATCGAGGCGGAGCACCAGAACGCGCTCCGCT
CGATCGGAGGTGACATCAAGTGCGAGAAGGACAAGGTGCGCGGCTTTGTGTTCCGCATCGTCAACAAGAAGGAGGAGGCGCGCATTTCCAAGCTGCCGTA
CGTGCACATCTGTCAAGTTCTCGTGAACGGCGTGCAGTTCACAACGGCCAAGCTCAAGTCGCTCGCAACTGAGTATCGGCGGCTGCGTTCCGAGTACGAC
AAGAGACAGACGTCCCTGCTCAACGATGCGATCGACGTGGCCAGCACGTATGTGCCTGTGCTCGAAGCAGCAACGGGTGTGCTCGCGGAGCTGGACGTGC
TGCTCGGGTTCGCGCACGCGGCTTGCCATGCCGGCTCGGGCTACTGCCGTCCTATGATGGAGGCGGACGGCGACACCGT