Description :
From Genome Similarity Track
Location :
Scaffold_42:46486- 51305
Transcript NameFunction/comments
Phyag_g1051hypothetical protein PHYSODRAFT_308312
Phyag_g1052conserved hypothetical protein
Phyag_g1053hypothetical protein PHYSODRAFT_470000
Phyag_g1054hypothetical protein PHYSODRAFT_468531

Sequence
4819 bases(100 bases per row)
TTCTACGAGGTGCTGGGGCTGgagacgagctgcagcgccgacgacgtccgCCGCGCGTACCACCAGGCGGCACGTAGATACCACCCAGACAAGCACTCAA
ATGCCGTGAATTTAGATAACGAGAAGCAGTTTTTGCGCGTGCAAGAGGCTtacgagacgctgcgcagtGATGAACGGAGACGAACGTAtgacgccaagct
gcagcaggacgaacTGGTGCGCAAGAGGGAGCAGGAGGCCGTGGTGGTGTCGGATGAGGTCTCATTGGCCGACATGAAGCGGGAGCAACTGCAGGGCGAG
GACggcgaagaggacgaggtcATTTATTCGCACCAATGTCGCTGCGGGGACCTGTACGAGATCACAGAGGACGAACTGCAGGATggcgtggacgtggtgc
cgtGCACAGGCTGCTCTCTGCATATCCGAGTACTGCAGGACAACGCCCGGTAACACTCCAGGCACTAGAGGAATATAAAACTTTCATTGTGGCATCTCTC
ACCTCTCACTGCGATGCTGTTAGCTTATAGCCGACGTCTTAGAACTCCTTGCCACGCGGTGCTCCGTGCGACGGGTATCGCTGCGGTGTCTGGATCTGGT
GGAGCACGCTCAGGCCAACGAACGCCAGGAACACGAACAGCAGGCCGAAGAGGAGACCCGCCATGATGTCGGGCGTGATGCTCACGTAGTGCGAGAAGCA
GAAAGCTTTGCCCGCAGCGTTGTATCCAAGGAGATAACCCGTCTCGCACAAAAGCGCAGCCTCGGCAGAGGagttggtcttcttggtcttcttgacttca
gcagcaaggcgcCGCGACAGAgggtcctgcagctccacggaGTTTGCGTCATTGCCAGTGAAGGCGAAATCCGTCTTGCCGTCCGTAGCTGTGCTGAGGC
TGTTGGACGCTGCCTGGatggcggcgtcgacgtcagGCAGTGGCATCGACTCGGGCAGTTGCACCACCAACATGTCTGTCTCGCCGTTGGAAAACAGCGT
TTTTCCTTCTTGGGACGCAATAAACACGTCCAAGTCCTGGAAGCCCACGATGTGAGGCTTGGCGCTCGTCATCTCGGGGAGAAGAGGCTTCGTGCGCGTA
GTGTGAGGaaccaccaccgacgacgccgacttcTGCACGGCATTCTGCACGAACGAAGCCGCTCCTTTAGAGAGCTGGGAAACGTCTTCTGAGgccagcg
acggcaacaagaacaagcacaTGAGCTCTGCCTGCGAGGTCGAAGATACCTGAGTGCTTAGCACACCCTGCAAGGAAAAAATGCTCGTTATCAGTTGAAA
AATGGCCAAACCATTTCCTAAACCAACAGAACAACGAACCTCCTTGTCGGTGGTCACATCGCGACTCAGCACGCGTTCAATAGCCGACGCCACAGCCGCT
TCGTCCATATCAGAGCTCAGGTAGGCATTCGACCcagcgaagatgctgcaaTTCATGACGATAATAAACTCTGTTAGTGTACGGACTCAATAAATAATAA
ATAGTAACTCTAGTACAGCAGAGAGCAAACACGCACGGGCGCTGAGACCACATGACGAGCGGCACGTGGGGGAACAGCGTGGAGGCCGACACGGCGGACG
TCGCAGCCGCCAGACCACAGCAAGCAACTCCTAGTAGCGTCTTCATCGTATTGACTCCACCTGCTGGTGTTCCGCTTTATATTAGATCGCGTCGGTTTCT
GCTTTTCGGACTTTAGTGCCCGATGTCGCTCGAAGGTTGCTTGAGCGACCCCTCGATTTTTTCGACCGATTCGTGGCTCACTCTACGAAGAAGCGCTCAG
GTACGTTGCGTCCCTATGACGTCTCCCTTCCTCGCTCCCCCTGCGTCTGTACTAGCCATACTGACTGAAACTTTACTCTATTGCTGTGCACGCAGTTCCC
CCCCTCTTCTTTTCATCGCAGTTGTAAGAGACAACAGCACGATGTCGTCTATCCTCGCCTCCCTCGACATGAGTCTGGACGACTTGATCGCCCgcaagaa
gaccaaggcCTCCAACCCGGCCTCGCGTCCggccaaggccaacaaggagaaggacgcggCCGGTCCCGTCCGTAGCGGGGGCCGTCGACGCAACCGCAAC
CGTAACCAGCCCTACTCGCGATCTGTAAGTGCTGCCACGACCTGAAGGGCCGTCTATTTGGCTATTTTCCActccctctcctcctctctcCGTCTCCCTC
TACTGCGCTACGCAAGGCAACCAACCCCTCTCTCCGTCGCTTCCTACCCGTGCGACGGACAGCTCAAAGCTCAGCTCAGCTGAGCTTTACGGAGCTTTTA
GCCTATCGCTCTGAGGGAGCATGGCGcctgctacatgtagctctGAGGACGGACGGACGTTTTCGTTGGTGCGGAATTTTCACACGTGCATTGATTCTCC
CTTGGTGTCCCAAAGCgcggcgatgatgacgacgacatggacaTTGACCTGGACGACGCGCCCGACAGCGGGAACAACCGCGGCGGAAAGAAACGCTCGG
TGGTCGTCAAGAAGGCTGGCAAGGCCGGCAAGAAAGGTGCGGAACTGGATGGCAATTGCTAAGGGGGATCAAGACTCCACTGACGAAGGCTTGTCCTCTC
CTGGCTTTTAGGCGGTTCATCCTCCATTCTGGCGCGTCTCGGCGGCAAAGATGCAGCTAGTCCCGGCACGAAGATCCTGGTGAAGAATCTCAAGTACGAC
ATTCTTGAGGAGGAAGTGCGCGAACTCTTCGGCACGGTGGGCGACGTGTCCAAGGCGGAGATCGTGTACGACCGCTCGGGCCGATCCAAGGGCATTGCTC
GTGTGTGGTTCACCCGCCGCTCGGATGCTGACAAGGCCATCAAGCAATACGATGGTAGGTGTCGTTTGAGGCGCGTAAGGCTATCATGTGCCTCGACTCT
TGacgctcttcatcttctacAGGACGTACACTGGATGGCCAGCCGATGCAGATTGCGCTGGACGCTGACAAGAACGTTCGCAACGGACTTTTCGGCACTG
CGCTTGAGCGTGACGACAAGGATGTCAAGTTTAAGGTGTCTTTCGGGTAAGCTATGCAAGCTGAACTCTGGTATGCTAGTGTAGAGGCGCTGACAAAGTC
TGAAATCTGTTCAACAGAGGAAAGGATGACAACGACCAACAAAAGGGCCGTCGCAACAGACGCCGCGGTCGTGGCAATGACAGAGGCAGCCAGGGGTGCG
TTGCAAAAtaatgctgctgttgtgaGGATATTTTTTCTTAACGGATGGGTATTTCATTTGTCGGGTTATAGTGGTCGCTCCAAGGAATCCGCTCCGTCCA
AGACCGCGGAGGACTTGGACAATGAGATGGACACGTACATGAAGGACGCATAAAGATGATGACGTGCTGCATCCTGGAGACCGGGTGCTGCCTCCAGGCG
AATCGAGCGCAAGGAAGTTCTGCCCTCGCGACTATGCATAGTTGTTTTGCATTTTAACGGGTGCGCGTGGCGGGCGAGGAGTGCCGCGAACACGTGAGAA
GACAAGTGGACGAATGACTTCTTCGCGACACGTGCCCCTATTTGAATAAAGCATCTCCATGAGCCTGAAAAATGGATCCCGGTCAAGCCAACGCAGTGAG
TCCTGAGCCAGAATGACGTGTGCGTGGCGCTCCAGTTTTGGCTTTGGACAGCCAAGGTCATCTCACGACGTTTTGTCCGACACCAACGAGTGCGCATCGA
TCGCGTCTtacagcagatgaaggcTGGATTTGGCGTAGGTTGCAGGTCGTGTGGTGTACCAGTATTCGAATCGATGTTTTCATTGCTAGAGAGATCTGGT
TGTGTGGAAGTTatcactacatgtacactgCAGCGATCAATACCGTTGCTTTAGAATAGAACAAGGCTGGCACTAggacttcagcagcaacacacaACTG
TGGTTGGTTTTGACGAGGCATAGAGCGTTCATTGCCAAAATCGGGCCACGGCGGATACACTAGACGATGAACGtaccggagacggaggaagagctgcaca
aCTTGCTTGTCAAGGGCGTCTTCGTGCTGGGCGTGGTGACATATATCGCGACGACTTTCATCACTGCACCCTACGGCCGTCACGTTCGGCCAGGGTGGGG
GCCAACGGTGAATACTCGGCTCGGCTGGGTCATAATGGAGAGTCCTTCAGCGATTTGGTTTGCAGTCGTGTACTGGTGGGGAGACCACTGCTTTGAGACG
ACCCCCATCATCGCAGCGAGTCTATGGGGATGCCACTACGCGTACCGCTCCTACATCTACCCGTTCCTGATCCGAACAAGCAAAGCGAAGCGTATGCCAC
TAACCGTGGTGCTCTCAGGGGATTTCTACAACGTGATCAATGCGTACATCAACGCTCGGTACCTGAGTCAGTTTGGTGActacagcaacgacgacccTTT
CACGCGTCCGTCGTTCTACGCCGGAGTTGTTCTCTTCGTGTTCGGGTTGTCCATGAACATTTACTCGGATCAACTGCTGATCAACCTACGCAAACCGGGT
GAGAGCGGCTACAAAATCCCCTGCGGCGGTCTCTTCGAGTACGTGTCGTCGCCCAACTACTTCAGCGAATTGCTCGAGTGGACAGGCTGGACGCTAATGG
CTCAATCGCCAGCAGGACTATCGTTCGCAGTGTACACCGCTACGAACCTCGTGCCCCGAGCTCTAAGTAACCACCAGTGGTACCAAGACAAGTTCCGAGG
AGAATACCCAGCCGGCCGCAAAGCCATCGTCCCCTTTCTGTGGTAGGCATTGCTAGTGCGTCATTGCAAGTGTAATGAAGCACAAGAGCTTACATTTCGA
TGCCGTCCACTTCAAGCTG