Description :
From Genome Similarity Track
Location :
scaffold_290:4648- 6582
Transcript NameFunction/comments
Pl_106514hypothetical protein PHYSODRAFT_347680
Pl_106515GPN-loop GTPase 1

Sequence
1934 bases(100 bases per row)
GCGTTCTTGAACACATGTCTTGAAATCACGGGTGCCAGCAGATCCGGTGCTTTCCGTAGCTCAATAGGCACTAGTACTCTGTAGTAGAACCTGCCTTTCG
CCACAATAGCCTTCTCGTTCTCTGGCAACGGCTCTAGAAACTGCTTCTCCGTCGCAACGCCCGTCTCAGCAGCTTTGTTCGCTTCCTTCGTGGACAACAT
CATGAATGCGTTCTCCACATGAGCGAGTCTGATGAACCACGTCGGTGCATTCGAAGCCCCAAATAAACACTGCAGTCGTCCACTACTCGCTACCACTTCT
TCCGGCATCTTCACGACGCTATACGCTGAAAAAACAATCAAATCATCACTAAAACCATCAAAAGTCAATCACGAGCGCGTTTTAACGGACCTGTGCGTTC
TTGTTGCTGCATCTGCTGTTTGCTCCGTGCAGACGACGTGCGTCCATTGGGTTTGGCCAGTTCCTGGATCCGCACGACCTTGTAGTCGCTCTCAGCGAGG
GACGTCGCGCGTCGTCGCATGTCGTCGAGTTCCGTCGTTTTGTCGCCATTTTCAGCTGCCATTTCGCCAGTCGAAGCGCCTCCCAACCCGCCAAAGTCGA
TCGAGTAGAGCTTGGACTCGTGCAACACGCGATAGAAGCGAGACTCGGTGAGCACCGCATTGCGCAGCGTTCGAGCTGTTGACACAGCGCGATGACGCGA
CGCGGAGGCGTCAGGAGCCTCCAGAGCGGCTAGAGCAGCTGCTACGTCCTCCTCGTCGCTTGTCTGAGGGATCAGACGGCCGTAGAACGCAGTGGACGGC
GCGGCAGCTCGCACGCGCGACTCCATCGCGTCTGCTTGGGGGGCAAAGGGAAACTGGAAGAAAATGGTTCATTTCATGTGGTGCACATCAACTGTCATGT
CCAGGTAGTCAAGGAGAATGCAGAAATTACAATGTAGACAGATAGACGGAATGTTAACGTATGTCCGGGTAGTCAGGAATGTATGTGGAAATTACAGATC
AGTGCGTTCGCCGGCGACGTTAGCACTGCTAGGCACGTCTTCATCGCGGTGGGACGAGATTTCCATGTCCTGCATGACGTTCGAGAGTGTGGCTTCTTGT
TGTTCGTGCTTCTTTTGCTGCTGTTGTTTGATGCGTTCCAGCAGATCTGGGAGATATTCGTTCTCGTATTGTTTGGCAGCTTCGTCGATGGCAGCGAAAA
ACGCGGGTATCCCCTCTCCAGTGGCAGCAGACACGCCGACAGACGTGAGGTTGTTGTAGAACTCCTCCAGCACCAGACTGAGCGAGCGCGAGAGACTTCC
CATGTAACTGTCGTCCTGCACTTCATCCAAAGCGGTCTGGAACGCCTCAAAGTCCGTCATCCACTCGGTGGCGAAGTCGTGCCGCATGACGTCGATCTTG
TTGAACACGACCACGAACGGCAGCTTCAACTTGTACAAAATGCTGCATGCGTACAACATGTTGGACATGAACGTGTTCGGACTCGCCGTGCGTGGCGTGT
CCACCACGTAAACAATCACGGACGGGAACGTAGACGCCAGGGACTCTGTGATGATTTGACCCGATGCGGACCACGTGAAAGCTTCGATCTGTCCAGGAGT
ATCTACAATGGCATAGCTGCAGCAACACCCAATTAGACTTCTACTAAGCAGTGAAACTCCAGTGCACGTACTCTAAATCGTTGCTGCGTTTGCCCAGCAG
ATCGACGACCTGGTCGAAACGGGTGGCGAACAGGTTCAGCGACGTCATAATGGCGCCGTTCGGTCCGAGTCCGTACTCCTTCATGACTTGTTTGTAGTCC
ACAGTGTCTCGGATGTCCACATTGGCAGTGTATCCGGTCTTCCGCACTGCAGGGTCCAAGTTAATCACATAGTTGCGCAGTCCCGAGTCCACTCCGTAGG
CTGCCAGTCGCTGCATCAGCGTCGTCTTGCCACT