Description :
From Genome Similarity Track
Location :
Scaffold_180:46479- 50808
Transcript NameFunction/comments
Phypl_g4814hypothetical protein PHYSODRAFT_566381
Phypl_g4815transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
4329 bases(100 bases per row)
tgttgGACACCTTTCGCTTgatgtggtgcagcaggtcggGCCGCCCGCGCTTGAAGTACGGGTGCTGGAACTCGAGGCGCTTTGAGTCCAGCACTGTCTT
GTGGAAGCCGTAGAGGTTGAGCTGCCGCACGAAGGACGGGAAGTTGCGGTGCTTGAAGAAGCGCGGCAACACCATGGCCACGAAGGCCTCGAGTTGCGAC
ACGATGATGGTGTCTCCGTTGGCGTTCCAGCCGCAGACGTGCGAGAACTCGGGCATGCTGAAGATCTCGTACGTCTTGGACAGGAACGCGGGTAGCATCA
CGTGCTTCCCCTCGgcgttcgtgggcgtggcTGCCTTGCCCTTGGGCAGCGCGGACGCCGTCTTGTCTGCGTCTATGAGGTCCGCGGGCGCCTGCACGGC
GGCTCCCTGCTTGGCCACTCGGATGCGCTTGGCCATGGCCGTGAAAACCTGTTTTCCTGCTGATATACTGGGCTGTTCGGGGTCGCGAGAGGCTCAGCGA
GTAGCTGGGTGAGCGGCGCGTCTGGTGGCCTGGGTCCTGCTGTCTGGAGCTGCCTGTGTGGTCCGTGAGCGCACGCGGCGTGGGCGACGTGTGCACTCTT
CCTTGTCCTTCGTTCTTCCTTCTGAGCGTTCGGTTGATTGGTTGACCGACCGCCTTTTGTATGCCGGAAAATGTCGGTCGAGCTTCGCAATAGTGTGGAC
CTCTGTGTTGCGGAATTGCTGGCTGCTTTCGTCAGACGGGACGGCTGACACCCATTGGCTATAAAAGTATTCCGCCAATCGCGAGAGAGAGGGCGATTTG
TCCGGGACATGTCCCGTTGACGCGTGTTTGTTTACCATCATTTCGAACGCCATAAGAACTCTCGGCTGCGTCGTGCAGCCCAGGGCAGGACACGtggagg
ctgcagcgcgcggcgaCTCCGCGTTCACATTGAGCAGCAACTCGATGCTTGCGCACAAGGTCGAAAGCCAGTCCTTCGCTTGCCTCGGAGAGCGGACCAT
GTTCGGTCGGTCGTGGATGAGTGGGACCTTCAAGCCACCTACTATAGTCCAATACCGTTACTGCAACTTCCGATCGGCTTTAACGGGGCCAAGACCAGCA
CAATTTCCACCGCACTGGCCGCATGACTACCAAGCGCCTGCATCAGACTGTTGGGGTAAATATGTTCGCGCGAGCACAACCTTATCAGCAGAAGAGCTGG
GACGTATCAACTAGAGCAAATGCCAGTTAAACCCACCTCAGACAAGGGCACGAGGTAACTTACCCCACCGAGACAAAGCCGCAGGACGCCCGAAGAGCGG
ATCGAGCTTGTTTCAATGCATAAGTCTTCTGCCACCAACCACGCAGTCGTATTACGTAGTAGAAATGTCCAGTGTGCCATAGTATTCATTTAGCACGTCG
GTGCTTCGTTTATATCCTAGCTGGTCAACAGCAAGTGTACGCACAGCGTCAATTGGTTGGCCGCCTGGCCAGGGCGCTGATATCCAAGCGCTTTCTTTAT
ACTGCGTAGTGTTTCACACGACAAGAGAAGCAGGTCATGGTTCAGACCATCAAAATGAGGGCAGCAGGAACCAGGGTGAAGCTCAACCTTTGATGATTTT
AATTATACGACGGGCAGCACCATTGTGGATCACAAACCTAGTAGCACCGTGCTGCTACTAGCACGGGATTCATGTCTGGAACATATTCTGTAGATTTAGA
AGACACGTTTGCTTCTGTCTACAACAAACTGATGGTAGGTAGTTTACGAAGAGCTGCGGCGTTTCTTCCAGCTAGAAAGCGAACCAAACCCAAACTGGAA
TAATAAGACGAGGATGCGAGAGAGCTGGACTTGATTGGAACATGCTCCGATTGTATACACGCATCGACAGCGGGGCCTTGCAAGTGCAACCAATTGCGTA
AATACCCATGTTTCCTACATGTACTATCAGATCGCTCTCAAAGCCGATAGAATATACTTTATCCCATTCAACGGGCCCCCCTCCATTCCGTTTTTACTCG
CTCTTATCAATTTCAGCGTCACCCATGTTCACTTCTTGATATGGCTGCAAGCGCCTCTGGtgcgacgtcgccgccgcctccgtcgtctccTTCGCGAGTG
CGGTGGCGGGGCGCGGACGCGTATCTGCAGTGGTCCAACTCGTACTACACGTGGCGCGTCGCAGGCACCGCTCTGCTCTCCCTCGGGtctctcctgctgc
tcttcttcacgagctccaagggcgtcgtgctcgacaTTTGGCTCGGCCTGCAGGCGCTCAACGTGTCGCTGgggctggcggcgctgcccttCGTGCCGCT
CTACTGCGTGCGCGAGGTCGAAGCTCCCAACACCGAAGCGTCCACGACCgcagcgaccacgagcgagcagctgctgggcgcgcgcgccgtcagctcgttc
tcgctctcTCGCTCGGCCTTCGACGCGCCCGgggtgacgctggagcgcacgtcggcgctggccgtctTCGAGACCATTGCGGTGGTGCAGACGGTGTCGC
TCTCGTggatcgtgctgctcatgctggcCGTCTATTGGGCCTTCGGCGACCTCACGGAGGAAGGAGTGTGGGCCGTCTGGACCGACCCCGTGTCGTacgt
cgcgctgctcgccattCTCACCATTGCACTGCACACGCAGCAGTTCGACAAGCTTCGTGCacaccagcaactgcagctgGGAGCTGGtctcgaggaggac
gagttgATGGCGGTGGCTCCGACGGCACTAGCGGGAGGAaatgctgctgttgctgcaacGGATACGGAGGCGACAGGCGGCAAGAATTCCAGTTCGAGTG
GAGTGAATACGCCCATCTTGCAGTCAAATCATGTGGACTCGTACTTGACGCTGAACCAGGAGCTTCATCcatgggcgacgacgcagaaCACAGTTCGGAC
AGTAGAAAGACAGCTGCGAGGTGCATTGTATGATGCTGCGGCGAGTGGGAACTGTGCAGCGGTGGAGaagttgctggagcgcgcAGAGCATGTGCTTGGA
TccaaggtgcagctggaTATGCTGCTCAATCGCATGTACACGACGCCCTCTCTTCTCTGTTGGATGTTCTCGCATCGGACGCACAACCCACTGCATGTAG
CATGTCGCGCTGGAGACGTTCGCGTTGTATCAGTGTTGCTTGAGGCGGGCTTGAATCCCAACTTTTTCGACAAAATCTCGGGCGCAACATTCAatctgga
gctgctgtacgagctgtGCCAGCTACGAGTGAAGAAAGTGACGCACATACTGGGAGcgccgctgcacgtggctGCATTACACGGCCACACGCAGGTGATC
GATCTCCTGGTGAAGCATGGAGCTAATTTGGATATTCTGGCTCGGTCAAGCTTTTTCTCGCGCTCGATGCGTGTGACACCAATCTTCCTGGCAGATTCgg
ccgacgtcgtggagTGCCTCATCCGCCACCGGGCGAATATCTTGTTGGTGCCGGGAGGTGGGAATGCCGCAAGCACAACGGTCCTGCAACGGGCACAGCT
CTCTGGTCGTCGCGAATTAGCCACTGTGCTAGAGGAATGGGGGGCTGACGTTGCGCTTACTCCACTACACgaggctgccgctgctggaaatCTTGCTGCG
GTGCAACATTTGCTGTCGTGGGGTATTAGCCCCGACGTACTGGGAGAATTCCAACGCGGAGTACACAGCCGTACACCACTGCACTGGGCAGCCGTGATGG
GAAGGCACCGCGTGATTAGTGAGCTGGTGAAGCATGGTGCTGATGTCAATGCCAAGGATAGCCATGGACGGACACCGCTGCACTGGGCAGCTCGTCATAA
CTATGCTGGGGCTGTAGaagagcttcttgctgtgGATGCGGACTTTTTGCAGTTAGACCACGACGGAATGACACCTTTGGCgtttgctgtcgatggcGGA
CTTCTGCGAGGTGATTGCGTGGAACTCTTTGTCCGTTTTGGGGCGGATATCAACGCCTTAGTCCCCAACGAGATCGATGAGACCCCTCTACACATCGCGT
TACGACTTGGATACAAAGATACTGCACTAGCTCTGCTTGTCGAAGGTAAAGCTGATCTGTACGCGCTGAATGGAGAGGGACGTCGTGCTGTCGAGTGTTG
CGCATCTGCTGAGTTGCAGTACGCAGTAAAGGTAGCGGGTGGTTGCGTCGACGTTGTTCTTTCGTTTGACCCGGTGTTTCGTGCGTTCGCCGAGCGTGTG
CGGGCCGGTATCGAGCAGAACTTTATGACGGTGTCCATGCGAAGCGTAGAAGAAGATACGGTGGGTCGAGAGGGAGGTGGCGCATCTGAAAAAtcgctgg
aggtggtgaagaATGCTTCGGCAATCGTC