Description :
From Genome Similarity Track
Location :
scaffold_47:46475- 48272
Transcript NameFunction/comments
Plaha_PHALS_00486hypothetical protein

Sequence
1797 bases(100 bases per row)
ATAAGCACATTTTTACATAAGTAGGTGTATCAGTACACAGATAGCGTAAGCTCTTTGCTGTCTATTGACAGGGTGATAGATGGAGAGTCAGGATCAATAT
TATACAATGAGTTGATGACGGATATTTAAGCAGCCAGGGCTCCTGCTTTGGTTTTAAACTAACGTCAGAGTTGACTTTCTCACAAATCAGAGACTCAATT
GCTCTTTACACTATAGTGTGCGCAAGTAACGTAGATAACATCTGGCCCGATCTACTTCATAACACTTCGTTGTCTATCTAATGACCAAGTTCGATAAATT
TCAAGACCTATATCACACTGCTTTTCCCTACCTTACACGGATCGAGTGGAAAGTTCTCCACTGATTCGCGGTGGCTTTTGGAGAAGCGGTTGTCCCGTCG
CTGCTGCGCTCAGCGATGCCCGACCAGCAATGTATAACAACATAACATATTATGGAACGTGAGCTGCCCGATGCAAATCGGCTAGCGCCAACTACATTAC
GTAGATTCAGAAGCGACAGCGTCGACTAAATACGTCCATATATTTTGGTTCCAGAGATGATTGAACTCCGCTGAATCAATAATTCCAAGAGATCAGCGAT
TGACATCGCTATATCCTAGAGACAGATCAATCTACATTCACAAAAGCGAGCTTTCTTCTCTTCCAGCCTTCATAGAAAACCTTACCCGAGCGGTTTCTCT
GTCCTTCAACAAGGCACAATGTCCGTGCGAGGCTACGTTCAGCAGACACATACCTTGCGACGTGTATTGAATCCAAGCCTATAGACATGGCCTTTTGTGT
TAGCGTTCGTGTTCGAGATGCATGAAGGCACGGCGTGCTCATGCCTTACGAGGGTCAATCCGTCCAGCTTTGAAGAGGCGTTCGCCCTGAGCAGCATGAA
AACTAATTTGTGGTAGCGTATAACTTTAGAAATTACGTCGATGTCTATAAATTTTGACGCTATTGTAGTGCCAAACAGCCGTTTACGTCATGAATCGCGT
CGAGCTGTAGTCGCAGCGGTTCTTCATTAGCAGATTTTCAATGCCGGAAGACCGGTCACCGTGCGACGTCGAGTCTGTAACCACTGACAAGCTCAAATGG
TAAGGCTTAGTGAGTGTAGGATACTCTACCCGCTCGAAGGAAAGATCAGTCTCCCCACAGACAGCTCAATCTCTAGCGCTACCGTGATATGTGCATAACT
CAAAATCGACGTCACGCCGGGCGACTCGAGACTGATCATCGTCAGCTTTCAAGTCGCTGGTTCCCGGAAACCACTGGCCGCGCCACTGGACTCAGGAGCG
GTCAGCAGCTTTCTACGTGTATCATGTTTGTAAATACTCCCAGTTTGCAATGGTCGAGGATAGATTGCTGCAAAGTTAGGTAGTGGGAGTTGCGACTCGT
CGCGCGTCGAGAGCTGACATTAACGTATCAGTAAAAAGGATTCCATAGCAATGACGAGCCACTCGTGATTGAAATGGACGACGCGTTCCAATGCATTTTG
GATATGCCGTCGATATCGCGTGACCAATTAGAGATTGACTGGTTGTCCGTCGAACGCCAAGGTAGCTAAGACATCAGCAAGGTTTTCCACCATCTCCTAA
TAGCTCAGAATTACGTTACCGTCATAGACTTGTCGCCTATCACGCGAGTTGTTTGCATATCGATCATGAAACGGATTGTGAGGTGCTATAAACGAGCGAA
CTGCCCGGAAACACGTGAGTAAAGGTGATATGGCGGCTGAGCTAGAACCCCCGCTGATTAATACTGCGGTCGAGCCAGGGCCTTCGCGATTAGCGAG