Description :
From Genome Similarity Track
Location :
Scaffold_226:46472- 49550
Transcript NameFunction/comments
Phymu_g7137conserved hypothetical protein
Phymu_g7138hypothetical protein

Sequence
3078 bases(100 bases per row)
GTGGCAATGGCTTCACTGGCAGGtttcgtgctgcttgtggttcttgtcctccttgtGCGACGTCGCCGGGGTAAGAAGAAACCTACAAGGACAAAGTCCA
CCTCTGGCGTTCACAAGCGAAGTAATGTGCAGTACGCCCGcattgatgaagatgctgctgctccgaaAGACCGACAGCTTAAAtacgatgaagacgatct
cTTGGATGCAGAATGCGGCGAGAGTGGAGCAGTCGTATCGAGACCATCGCGTTCATCAAGCCAAGATATTGTGTAATTGCCAATTTACGCTTTGTTGTAT
AATACTAAACGAAGACCtttttagttttttttaattgtTTTTCAGTTTACAGCTGGTGACGTCGCGACCATCTTATAATGCGAAAATCTGAAAAACATGA
GGAAACATGTTTGAAGGCGGTTTACTCTTCCAAACCGCATAAGACATCTGAAGGATGTCGAGATCTATCCCGACATCCTTTTCCGAGCGCTTCCATCTCT
CACATTGCAACCTAccacttcaccaccaccTCTCTACAGCTTTCAGCCTCCACCTCTCTCTAGCCTTCAGCCGCCACCGCTCTACAGCTTTCAGTTCCCA
ACTCGCAAGCCTTCAGCCAAGTCCGCCACCATGCAACGCGCCAGTCGCtacatgacgctgctgctcgctgctctttCCCTCtcgacagcaagtgcaggaT
CGGCTTCCTGTCAGTCCGTACTGGGCGGTTCGTACTCCTCCGCGGCCGCCAACTACCCGAATCTCAAGAACCAGATCGAACTCatcgccaagcagcaggt
tgcCCAATGGTACACTGATCGCATCTCGGACGTGGATTCACTGGCCAAGTCGGTTGTTCTCCCGTTCTGCAACGACGCGCGTCAAGAGGCCAACACGCCC
GTCATTGTCGTCTACGGTTTGCCCCAGAAGGACTGCGCGCACGGATTCTCCACTGCCGGGTCCAATTCGAACGCTGCCGACTATCGCGCGttcctccaga
agctcacAGACGCCGCTGAAAACCGCCAAGTCGTGTACATCCTGGAACCCGACGCGGTGGGGCTGTTGGCGGACGGTGCGTGCGGTAACGACAACAACTA
CGCCGCGAATCTCGGTGTGGCGATGGACATCCTGTCGCAGAACGCCAACGCCGAAATGTACCTGGATGTGGGGTACTGGACGCTCTCGAGCGATGAGGAC
GCAGCGGCTGTAGCGAAGATCGTGAATGCCGTCGACCCACAGTGCAAGTGCAAAGGGATCTCGCTCAACACGTCCAACTACCGGTCGAACGCCGAGATGG
CGACAGCGTGCGAGCGGTTTGTCAAGGCCACGGGCAAGGACTACAAATGCATCGTGGACACGTCTAGGAACTACGTCGCTCCTCCGTCCAACGAATGGTG
CAATGCGAACTGGGCTGGAATTGGAGAGCTCCCCTCAGCGAACACTGGATCGAGTCTGATCTCACGCTATGTCTGGCTCAAGCCCCCGGGTGAGAGTGAC
GGCCAGTGCTCCGGTCAAACGGACAAGGCTCTTCGAGGTCCGAACGCGGGCGACTTCTTCCCCGACcacttcgtgcagctctggGACAACGGCGTGTTCG
TCCAAAAGCTCGGAATGGCACCGATCAATGGAGCtgccaacaccagcagcaactccacCGCTACGGCACAGACTGTGACTCAAGATGTTGAGATCACGTC
GCTGTCGGCGGTTGACGTTGATGATGCGGCGGGTACGGTGCACGCTGACGACGAATGGTCAGAGGACGACAGCCAGACGCCGACGCCTACTACGCCTACA
CCGACCACGGCGGCTCCTGTAGCCGTGCAAGTTGAGTCTCCTCACACGATGGTGGTGGTAGACGTGATCCCGGACGACGAGTACTcggacgagaacgagg
aaTCCGACTTTACCGGTTTAGACGCAGACTCCAATAGCGACTCTGGCCTCATTCGCCAACACAAGGCGTGCGTGTAAGTAGAACGCACCAGGAGGAAGTA
AAAAGTGTAACCTAAAAGGAAATAAAAGCTAAATGTAGTCTTGCAAAGTATCGCGCAAATGAGCTGAAGATAGCTCTGCTCCTTCATGAGATGGTGCAGA
TAACGGAAACCAATAGAGCTTCACCCACAGACGCACCATTCACCTTTCGAGCTGTCCTACGACGTCATGCAGCGTGAAGAGTGCATCTATAACTTGATCC
CCAAGGAGCGCGTGGAGCCTGTCAAGCCGGAGCGGTACCGTTCCAAGTTCGATCCCAATGTGCAGCCTACAGGAACTACCTTTGGGGTACGAGGCAAGAC
AAAACTCGAAGGAGCCAACCTTGGCGCAGCTCACAGGTTGGAAAAACCTGCCAGCGCTCGTGGTTTCGGCCGTCTACCGGCCAAACCGGACCCCAAGTCG
TTTATTCGCAAAGGTGAACGGGCCTCCTCCGCTGTCGTCTCCAAGAAACGTGAGCTTGTTAAACTTATAAACTATGGAAGGGGACGTACAAATGTACTCA
CTCGTGCGCTTGATCTGCAGCGGGGAAGTTCAATTACCCAGGAGCAACTAGGCCGCCGGTTGtaaagaaggaggacaagcCAATAATGGGGCTCAAATCG
GCCAAGAATTTCGTCACAGCCAACGCAGTCGAAACGATCCTTGCCGTACCAGGAAATCGAGCGCGTGCGAAGAACGAGCCACCGCAGTACttgcagaagg
aggactATGGCCAGGTCCCCCGGTACTTGAGTCAGGTGAAAGACGAGATTGAACGCGAGAACTCGATGATCGAGGAGTTTGTCCGACAAAACCACAATTT
AATGGAGGAAGACAGCCGCGATCGCGTGGAGCCCATGGACGAGCGCGAGCGGCTGGCGCTTGTGGACGCGCTCAAGTCCAAGTGGGATCACGTGAATGCC
AAGTACCAGAAGCTCTGTCACAACGTCGTGTTCGACACATTAGGCAAAGTCCGACGAAAAGAGACGTTCGAGAGGGAGCTCACTCAGCTCGAGAAGGACA
TTCAGTTGCTGGAAAAGGGTCATGTCGTCATCAGCCAGAACAATGACCGCTACTGAAAATTCCTCACAGTGCCTAATA