Description :
From Genome Similarity Track
Location :
Scaffold_33:464640- 467196
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010856Protein of unknown function
Pytul_DAOMBR144PYU1_G010855Similar to Xpot: Exportin-T (Mus musculus)

Sequence
2556 bases(100 bases per row)
CTGCTTCAGCAAGTTGGAAGCATTCTGGGACGACGCGCGCACGACGTTCTTGACGCGCTGCGCCATGAGCACACGCGAAAACTTTTGCTGCTCGCAATCC
TCGCGCCATTCATTCAGGTACTTGAAATCAGGCGGCAGCATCGACGACGACGCTGTCGCACTTTGCGAGGAAAATCGGTGCAAGTCCTTGGCCAAATGGA
CCGCAAAATCAAATAAAGGCGCCGACGCTAGGAGGCTCCGGATGCTCTGCAGCCAACAGTGGTGGTCGCTCAGCTTCTTCTTCAGTAAGCCCAGGTGACG
CTTCATCTGGAACATGTGGTGGCTCGCGCTTCGGTTTTCCTCGATCGACGGCAGCGCCGGAGCCTCAAACTTCGACCGCAGCAGCACGATTTTCTGTCGC
AGCCGATTAATTTCCGTCGTGTACGCCATGCTTTCGTGCTTCTGGCGCTTGCGGCACCGCTGCGAGGCCTCTTTCAGCTGCTGGCGTCGTCTTGTGCCAT
CGGCTTCCACTGGCGACGGCGCGACGTTAGCACTCGATGGGGTTGAATTGCACGCCTGTGCGCTGAGCACCGCGAGTCCGGACGTGAATGCAGTCGGCGA
CCATGTCGCATCGTTGTCAAAATGCGCGGCTTTCACAGCAGGCTCGTCGTGAATGCCACCGTCGAGACTGTCGTGATCGTCAAAGGACAGATGACGCTCC
AGCACGCGTTTGCGCACGCGACAATCGCTTCGACTGAGCGCTGCTGGGCTCTTCCTCTCGTCCTGATCGTGATGCGTATGGTGGTCCACGAGCGGCGGCC
ATGCATCTCGGAACGTCGTCGTTGACGCGTTTTGCGCAACGTGCGCGCGGTCGGCCAACGGCGGCAGGCGCACATTCGCACTCGCTGCAACAGAGCTCGT
GCTGGCGTCAGCGTCCCGATCGTCACCGTCTTCCGCGGCGTCAGCATATCCACCCGCGTTGACGAGATCCTGCATCCGCAGCATCGTCAATCTTCTGCGC
GTCAAAGTTCCGAAATAGTGCAATGAAGCGTCGCCACACACGCACCAACGCATCGTTCAGCTTCGCGACATCATGGCCGCATGGCAAATGCGGGACGGGG
AGGACCGCGGAGCAAAACCGCACACACAGCACACGTCTTTGCAGCGCAAATGTCACCGTTTGCTTTTTACAACGGGGGACCGTCGCCCTCGTCGCAGTAT
TTTTAACGACTGGATGGATGACGTTGAAGTGACAGATCCTTTTTCTCCTTGTTTTATAAACTTGCTAAATTTATAGATGCAAAAAGTTAACACTGCTAAT
GTTATAAATTATATGAGTGGTGAAGTCAATTCAAAAAGATGAATTGCGTAGATGCAGAATTGTACCCCCACCCCCTTGCTTCGTTCTCGTGTTGCGCCAC
ATTTCTCTATTGGACGAGTGTGCGTGCAGTGGTGACAACGCGCGCGCAACGAATCCTCTCAGGTGCGCCGCCAATGAGCACCTAATGTACCTACCACTGT
ATGTCTGACGCGCGTGTGCTGTGTGTATGTACCTCCCCGTGTGGCGCTGCTGGCGTTTGCAGTAAGCAAGCCCCGCGAATCAAATCCACCCATTCCGCAG
CCACTACGGAAAAAGGGAAGAGGTAAAGCGACGAGCACTTGAGAGGAAACAGTACAGCATGGCAAACACGATCTCGGAGTTCGAAATGGCTGTGCTCTGC
GCTTTTCAGTACGCGAGCGCGAGCCTCAAGGACCAGCAGGCGCAGGTGCTCAAGCTGCAGGCCGAGAGCTTTTGCAACTCGATCAAAGCGAGCGTCGACG
GGTGGCGGTATGAATTGGAGCTCTTTGAGTTCTCCGAGCACCAAGAAGTCAAGTTTTACGCATTGCAGGCGCTCCAGGTGCGTGTCTGTCTGTGCAAAAA
TGTGTATCCGTCCCTGTGCGTTTCTTTCGCAGTGGGCTAATGTACACACTTTTATCTGCGGTTGGTTGGTTGCATGTAGGAAGCGCTTGTGAAAGGCGTG
GAAGACGTCGTGTCGGCCCAGATCCGCACGGAGTTGCTGACGTGGCTCCAAGAAAACGTGTCATTTGTCGAGAACAAAGCACCGTATCTGAAGACCAAGC
TCGCCGTCGTGATCACGCTACTGATCAAGCGCGACTACCCGGATCGGTGGCCGACGGCGTTTTTCGAACTGATGGCGCTGTTGCCAAAGGGAGCGTCCAT
GGTTGAGATGTATTTCCGCATTCTGGTCGCGATCAATGAGGAGATCGTCGAGTTTGACGCACAGCGCTCCCAGGCCGAAGCGAATGCCAACATGCGCATC
AAGGACGCGATGCGAGAGAGCTCGACCATGGCTGAGACTTTCGATGCGATCTACAATGTGCTCGTCAACTGTGATGCGAGCGCCGTCATGGTCGAGCTCA
GCTACAGTGCGCTGGAGACACTGAAGCGATACATCAGCTGGGTCGACATCGGACTCGTCGTAAATGATCGCATCATGCCGCTTTTGTTCAAGATGCTTCG
TGAAAGCGCGTCGCTGCGCTGCCCTGCTGCGAACTGCTTGTTTGAGGTCATTGACA