Description :
From Genome Similarity Track
Location :
Scaffold_193:46456- 48692
Sequence
2236 bases(100 bases per row)
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCA
CTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAA
TGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCA
CAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATC
GATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCT
CTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGG
GTTGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCT
GGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGGGGTCTTTGTAGACCGATTGAGCAAGATGGCTCA
TTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCG
GATCGAGATCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATG
GTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTT
CGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAATCCTCGCGTCCCACTGACGCCGCCACGAAGTGGC
TCAGGGCTTGGTGGAGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCAGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCG
TAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAAAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGG
TGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTCATAGGACCGTTCAAGGTC
GTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTCGGCTTGCTTATGCCATACCAAGACCCTG
CTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGGCCACGGACAGCTGAAGGGCAGCAGGTGGTAGAGCCACGGGAGGCTGAACGACAGCAAGT
GGTGGATCCACAGATGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTACTCGAGATGCAGGAGCAAGGCAAGCTGAACGTTCAGCC
GAGCAGCTGGACGCTCAAGGTCCGAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAGCCTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGATGG
GCGGTGAACGCTCGCGTCGTGGACGCCGGCGTCGTATGGACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCC
TCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAACGCCTTGTAACGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTAGTGAAG
TGGAGGGGTTACCCTCACTCACAGAACTCATGGGAG