Description :
From Genome Similarity Track
Location :
Scaffold_43:46446- 47981
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_43-fgenesh-gene-0.18Receptor expression-enhancing protein 5
Pytul_var.sporangiiferummaker-pug3_contig_43-fgenesh-gene-0.28Ribose-phosphate pyrophosphokinase
Pytul_var.sporangiiferummaker-pug3_contig_43-snap-gene-0.57Ribose-phosphate pyrophosphokinase

Sequence
1535 bases(100 bases per row)
GCGGCGGGAGATGACAAGGAGCCAAGGGGAGACGAAGACGCGCGGTAATCAGAAGCGGCGTACGCATCTCAGCCCCCACTAGTGATCGTTCGTCGTTGTG
CATGAAAAAAAAATCAATACATTCTTCATGTTGAGTCTGTCAGGTCACGAAAAGCAAACGCAGTAGGCAAAGTGTAGTGGTGTGTTCTTTCTCGTGGCTT
TCCTTGACAGCGACTACGAAGAGCTTAGAGGTGGTGCGTGTACTTGTAATCTTCCTTCGATGTCGGCTTGTCGATGTACGAGTGCGCCTTGAAGTGCTCG
GCCTGGATCAGCTCCGCGAGCATCGGCGCCACAGACAGACGCTTGATCTTTTCCGAGTGGAAGCCCTTTGGGCTCTGCGGGATCGTGTCCATGACGACGA
CTTCCGCGAGCGGCGATTCGTCGATGATCTTCTCCGCGTCGCCGGCGAGCAGCGGGTGCGACGCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCTTGCGTGCACCCTTGTTCAGCACCAGCTTCGTCAGCTTGGACAGCGTTTCACCGCTGTCGATCATGTCATCGACAATGATCACGTCGGCGCCCTTCAC
GTCGCCAACGACATCTGCCTCCGTGTAATCACCATTGTTGCCCGTGCCGTGGACAAACGCCGCGAAACGCGCAGGAGCATCCGGGAGCCACTTGTTCAGA
CCCGCCTGGAAGACGCGCGCGCGACGCAGACACTCTGGGTTTGGCGCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATTCGACACCAGCCATGATGGTCTCGAGGGTCTCCACAGGCACGTTCGAGCTGAAGAACGACGCCTCGTGGCCTTGCATGCGCAATTGGAGGTCGA
CGGCGATGACGCGATCGACGCCCATGACTTCCAGCATCTTGGCAATATCGGCTGCAGGGCTCTGGATGAACTTGGAGTTCATACTCGTCGACATCGGGTT
CGNNNNNNNNNNGCTTGTACGCATAGTATCTACAATCACACAACGCCGAGATAAGAAGAAATCACGCTCGTTGTGCACCACAACGACAACTAGCAGCACA
TATAACTTACGGAACGACAACGGTCACGCGCTTGGCACTCGCTCTTCGCATGGTGCTGACCATCAGGAGCATCTCGATGACGTTTTCGTTCACCGGCGTC
GCGAGACTCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCCTTGCCGCGCACACTCTCGCCAATCTGGACCTGCACCTCACCA
TCCGCGAAGCGACCCAGCTTCATCTTGCCCACGCGCGTGCCGAGACGGCGCGCAATGTCATCGGCGAGTTCAAAGTGCGACGAGCCCGAAAACACCTTTA
GCTCGNNNNNNNNNNGCAGCCGGGGATGAACATGCCGGCGTGCGTGCATGGGTGCTTGTCCGACGGGAAGAACGGCGAGTGCGGGTCCACGCGCTTGCGC
TCCATGGGCACGCCGAACTCGAGGTCGCGAAGATC