Description :
From Genome Similarity Track
Location :
scaffold_810:4644- 5736
Transcript NameFunction/comments
Pl_102315hypothetical protein PHYSODRAFT_542669

Sequence
1092 bases(100 bases per row)
AAAGTAGAAATATCTTGTTCAGAGTGGGAAATAATCTAGGACAAATGTGAGAATAAACTTCTGCCTCTATTGTCGTAATCTTCTTGGTTAGGAGCCTTTT
TGACGACGATCTCAACTTTACTAACGATGTGCCTACCATGATCACGAAAATGTGGTTGTCTTACACTTAGAACACCTTCCACACAGTGGAATACACGCCA
TCTCGTATGCATCGGGAATTGCTGGGATCCTTTGATAGAGGAGGTACATCCTGCCTGATCAGCCGCAGCTCCGTAATCTTCTTGGCCTCGCACCGCCGAT
GCGATATTAAAATGGCTGAACGCCGAGCTGACAGACCTCAGGAAATGTCCTAGGAATCGTTGGCCATTTTGCAATTTCGCGTCTAATCCAACACGAATGC
AGCTGGTTCCACTCATTTTGGTTGTCGTGGTCGTCCTGACCATCACTGTGGACGGTATCACGCCCTCCGAATCGGAGTCCAATGCATCCGACCTCCGTCG
CGAACTATCTAGACTCCATGCACTTGGAAGAACGAGCAAGAAGAGGCGGAGGAGGAACTAAAATTCGACTGACGGGACCCTCTTGGTTTGTTCACTTTCC
CAACTCGCCGCATCTCGATGCCGCTGCGAAAAAATGGCTGACTAGCTATTTACAAAAGGTGAAGAAGAAGATTACATCGCGTCGACTTCGACAGTCGAAG
CAATAGTCAAAAGATTGAAAGGGAGAAGAATGAGATTTTCCATTGTGTTTCAATCAGCCTTCCGACATATTAAGTGGAAAATGACTTTGTACCACAGAGA
GATTTAATCTCATTTTGTGAGGGAAACTCGAATAGAAACCAAACTATTGGCAAATACTACAGCTGCAGTACCGACTCAAATGCTTACTGTGTTCGTCTAA
CTTGCTAACCACGTTTTACACAAAGTTAATGTGATAAATTGACTTAGCAAACCACACTTCAACGCAAAATCTGCTTACATGTTTGAAAACATGTTGACAG
AAGAGAGCGCGGTGGCATAAGTCACCGGCCAGTTGCTCCAGTCGACATCAAATAGAAGCGCAGACTGACACGAGCTACCCAGACTTGCCACT