Description :
From Genome Similarity Track
Location :
Scaffold_235:46438- 47905
Sequence
1467 bases(100 bases per row)
GGAGCCTGGTACTCGTGCTCGTACGAGGGCACCTTCGCCTCTGCTTGATCGGAGCGAAGACGTCGACTACCTCGTGGAGCAGGTTCTCCAGGAGCAGCGA
CTTCGCGGGAAGCCCTAGCTTCTCGTGAAGTAGAGGGGTTATGCCAACTCCGATAACTCGTGGGAGATAATTGAACGGCTCCTGATAGACTGTCTAAAAG
TTGTCGCAATCTGGGAAGAAGCGGCGGCAGCTTTGTAAGTAGTCAGGGGCTTTTTGCTTAAAAGGGTACGGACGTTGATGACACTCGATCCCACGCTCAT
CGTGAGAGCTAGAAGCTGCGCGCTTCAGAAGGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCGAACCGGACACAAAGATCACGCTGGCTTCGGAT
GCGAGACTGCAGCTGATTTTCACGGAGTTCCCGTAACTCCGAGGATGAGTACTTGATAGACTCAATCCACACCCAGAACGTGTCCTCGCATGAGCTCCAG
CTCGGACAGTTCTCGGGAAGAGCCCAGGGGTAACCCCATAGAGGGTATAGACCACCTCGGTTATCAGACTTCTTACGATAAGTGGTAACGGCCTTAAGCG
GGATTCGGTGCGACGCGAGAAGCACGCAACGGGCCGCCTGAAAGTTGTCGACAAACAACTTCTCCTTCTGGAGAAGGGAACGTTCGTAACACCCTTCGCG
GTGTGGCCACCGAAAAGCCCACGAGAAGCAATGGGAGTCCCAGAAAGAGATCAGCCCCAGAACTCTCCTCGGGAGGCCAATAACCTCTCGGGTGGATGGC
AGCTCCCTGGATGACGGGTGTCGCCACCGGACCCCACGCATGCGCCGGTCAGGTTGAACGCTCAGCTTTTGCTGATCGAGGTCTCCCGGGGCTCATCGAT
GACACCCTCCTATTCCTCTTTATCCGAGGAGCCAAAGAGACCCCGATAAGACTAACCAGTCTCCTTTTCCTTGCGGTGCGGAGACCTTGAAGCCGTGCGC
TTCTTTGAGGGCTTGGCGTCTTCGGCTGCGGCCCCAGCAGTCTTAGCACGCGCAAGACTCTCGGCGGGCGAGATTTTTTGAGAGATTTCGCTTCCTCGTC
GTCGCCAGCTATGAGCATAGCCTTGACGGCAGGACGCACATGCATTTTAGGACTGTGATCACCGTGATCCCTAGAGAGACGGTGCACGCTGTCGTCGTCA
TGCGCGTTGGGTACTGGAGTGTGCCCTCCCGCGGAACCCACATGAACATTAGGGAGGTCCCCGGCCTCGGCCTTGTCCTCACAGCTTGAACTGAGCACAC
GTTCAGCGAATCGCGGGCTTGGTCGGCTACCTGGAAAGACCGAAGGTGACGGACGGCGGCGTTTGCTTGCGCGCTTGCTCGCAGCCGTGTCACCGTACGT
ACCGATCGCCTCCGAGGCCACCTTAGTAGCCTCTTAAAGTCCAGAGACTTTGCCGCGTGGATTAGCC