Description :
From Genome Similarity Track
Location :
Scaffold_916:4643- 8669
Transcript NameFunction/comments
Phyta_totarag11337hypothetical protein PHYSODRAFT_323353
Phyta_totarag11338hypothetical protein PHYSODRAFT_538076

Sequence
4026 bases(100 bases per row)
TGTTagcgacgccaccagcatGACACTTCGCATAACAGTTGAGGAACATCACCATTCGTGTCACGAGAACAGCGCCAGCCAGAGCAACAGCGAAGAATGT
GATTGACATCACGCTGTACACACTCAGAGTGTACTTTGAGTCTGTATCAACACATTACAATACGACGTGAGTGCATATATCCGGTACAAGAGGTAGCATG
ACCAAGTACGTACATGTCTTCGCGTGCACCAACGTCTGTGCGCAGTCGCTCCCCATCGCGTCGTTATCGTCCATCAGAACAACCTCGCTGAGCGGAGGCA
AACGGAATCCGCCTGTAGGACcgtcctccttgtccttATCACCAGTCCAGGCTACGTTAGTTACCTGAATCTGGAATGTAAAGGTCGTCCTAATCTCCCA
CGAATCGTTTGTTTTGACACCCGACGGAATGAGGTCCGTCACGCAGAAGTAAGTATTGTTGTCGCTCTCGATGTTCAGATTTGTATCGCCTGGATCAGCA
TACAGGTTGAGGAACGGGTTTCCGCCTTGGACGTACGAGGCCGCCGCAGAAGATCCGAAGGTCACAGTAGAAGTAGGCTCACGTCCTTTGCTTGCGCAGT
ATGAGGAGCGCAGGTCAATACAAACTTTTGGGTTGTCCGAGTTGGGACCAACAATGGTGGACGTTGAGAACGACAACATCATAATTTCGGTGTCCTCTTC
CATCCACACCAGCGACGAATCCAGACGACCTCTCCGGACAGAGGGCAGCGCCATCGTGGCGAGAGTTAGAGCGCTCAGATCTTCGACCGAGGTAGTTGAG
TCGGAAGATGTCACCGTTAGCTCCCGCGTACGTCGGGAAGTGGCAGCAGACTTAAGAGCTCCGGACGAAGTCTCATAAGATAGCGACACGCTTACACCCA
CAGAGCTACTTGAAGCACTAGTGCCTGTAACGATACTTTTTGAAAGAACAAAATACATCGGGCCTCCAGAGCACGACGCCATCAAATCCTCTCGGCCTTC
AAGTAGATCCatgacgtcgacgaagccgtACCGATGGGTATCGCTGTCGCAATTCTTGTTGTTCGTAACGTCAGTGCAGCTGTACACACGCACGGCGGAC
ACATCTTCATCATTGTCATTGCGCAGtgtcacttcaactgcagTGTTTTCCCATGCAACAAATCTCCAACCACTAGGGAGAGAAATAGTGATCCACCAGT
TGCTTTTACGGGCCATTGGGTCCTCCTCTCCCAAGTTGTAGAATGCTCCAATGATGTCGGCAGCCAACAGTGTAAACGTTGCTTCTGCAACACTGTTAGG
AGTGACAGTTGACGTCGAGACTTTGTAGGAATCCGTCGACACGCATGTCTTGTATCCTGATGGACACGAGCCATCGGAAAGCTTGCTTTCGCACGTAGAT
CCGCTGGAGTCTCCAGGATACTCGTTCTGACACTCCGATGCCTTACACCGACAGTAGGTAGAGGTGTACGGCACGTATTCCCCACTGCCACTCCACTGGA
ACAAGCAAAGAAACACAAACACCATAGTTAGCACAGATGATACCACAGCATTCGAAGTGCGTCGAATCGAAGACAGTGTTGCAACGAACCCAGCTTTCGC
TTCCAGACTCCGATTCACTCGATGAACTGTTGCTCGCTGTGAGTGAGAAGACCTTGACGACCTCGCTCGATCCGCTGTGAGATTCTGACGCTGTGGAGTT
CGCTGGAGACGATACTTCCGTTGGCACCGCCGATTCACCGGTGGAAACAGTCAAGTTGCTTGGTGCCGCGGGCGAGGGAGTTTCCTCAGTCGTAGCCACC
AAGAGGTTTGAGCTTGGTGCAGACGTTCCTTTAAGAATATTGGAGCGTTCTTCTGTGTATCCCGACGACGCTGCTTTCGCAGCGGATGCACTGTAATCAG
TGGAACCAACGACTACCTGGGCGCCGCCAGATCCTCTGGACACATCCACGTTTGAGGGGCTCGCAGTGCTCTGGGCGCCAGGTTCGATAGCTGAAGAACT
GGCAGAAACCTGGATGCCATTGGAGCCTACCGAAGTATCGTTATACGAAGAACTAGCTCCAAGGTGAAATCCTTGAGAACCAACTGACGCATCAATATCt
gaggagctggcggcgaCATGGATGCCCTGAGAACCCACAGAGGCATCAATGTCCGACGAACTAGCTGCGATGTGGGCACCGCCAGACCCAACAGTTGTGT
CAATATCTCCAGAGCTGGCGTCAATATGGATCCCATGGGAACCAACAGTGACGTCAAGATCACTGGACCCCACGGTGGCGCCAATGCCACCAGAACCAAC
CGACACATCCAAGTCATGGGATCCAACAGAGACTTCCAAGCCGTGTGATCCTGTCGAGATCCCCGCACCGTTGGATCCCACCGTCGCATCCACGCCATCG
GATCCTACTGAAACACCAAGCCCAGTCGAGCCCGAGCCCACCGAGACGTCGATGCTTCCTGAACCCACTGCGATACCTGCCGATCCGATGGAGATGTCCA
ATCCAGCCGAGCCTAGTGTGATGCCAAACACCGCGTCCTCGTTCTCCGCCGCTCCTGAGCCTGCAGCCGCGCCACTGACACTCGCAGATTGACTGCAGTC
CTCCGACTGCGGAAATTCGACCGTCTCTGCGCCCCCAGCACTTCCCgaacagctcgaagaagtccCTGGTCCGTCGACTAAATGCAGCAGTAAATCGGCT
CCTGGAGAGTTCTGGACGACGGGATTTCGTCCGTCAGCTGCAATGTCTCCTCTGGCTATCCTCGTCATGCGCTCGAACTCCAGTTCCTTCACATGTTTCT
CCAAGGCCGCGATCGCTGGTACCGAGTCCAACACCTCTGCGTCTGCGCGAAATACGGGGCCAAAGCAGGCGTGAGAGACCTCATTCTGCAGCTAAAAGAC
TAGAGAACCTATTGTCGCGTACCTTCGGCCGCGGATCGGGCCGGCAGAGTCGACGCAGaggccagcaacagcagcagcgccgccgcgtACATGTGCCTCC
TACCGCCTCGCAATAGTCGACGCTGCGACAAGCACAGACACAGCCAAGAGAGCATGAGACGCATAGATACATTAGGCGTGGGTGGCAGAGATCGGAGGGG
CTTAGAGGGCCGCTACGTACCCGCATGGGGAGCCGCCGACCGACGAGTACAGTGCGCGCGCAGGTGTCGTCTCGGTTTGATTGTGAGGAAGCGCGGGTTG
GGTCAAAAATTCGGCGATGTGACAAGGTCCGATGAACCAGTTTAATGGGAACGGAGAGGAAGGGAAGGTGCTGGCGTATCTGGACCTTTTGTTGAGGGAA
GTGTATTGTATTTTATAGAttgcagcttttgctgctatGACCCGGAAAGAGATGTGTTTTCGATAGTGGCACCACGCTGATGGCCTCTGGCTATTCGCTC
TGACCTCGCCTAGCCTGGTCTTGGTATGGGGAATGCGAAAGTGTCTGCAGTGCGTGCGTGGCCTTTCGATGCTGATGAAACCGCCACTGCCACGAACTCG
AATAAGCTCGAGAAGAATGCAACTGGAATTGCGCTATCGTGAGTGAATTCATCCACGCAGGACTCCGTgcatgtccagcacctcaGATTAGGAAACTTTT
TCGTATTCCTTACAAGTACACTATACactagtacatgtattcacttgagcttgcgctttcgtattcctgttgagcgggtATTACACATCAGAGGATTact
accgaggggattgtctaTTTTCGGAACATGTAAACTGTGTGCGCCACACAACTGGTTTTGTCCAGCCATTTTCACGCCTCCTCGGTCTTGACTTGCCTCG
ATTGACATTGGTGACCATGGTGAACCACGACAGCGGCTcggagcacgacgacgtggagaagatcgtgCGTGAGGCGCCCAAGCGCCTGGGACAGGACGCC
CGCAAGCCCGAGAATGAGAAGGCCAAGCCCATCAAGCACGTGGGAAAGTACACGcgcagcggcggcgtctCGCAGCACCGCATCCGTGGCATCCGcgaca
agaagctcaagggcTCGTTGCAGCGC