Description :
From Genome Similarity Track
Location :
Scaffold_55:46427- 50377
Sequence
3950 bases(100 bases per row)
GCCTTGGTTTTGGTCGAGACAGTGCAACATACAGTTGTCCGTGAGAGAACACCGGGCTTGGCAAGATAAGTCCCACGCGACTAAACGTTTGGCCCTGAGA
CATGTTGATGGTCATAGCAAATGCCAACTTCACTGGAAACTGGCGTCGCTTCAACTTGAAAGGGAGGTTGGATTGGCTGCCCTCGTCGACCAAGGTGATG
CGCGGTACGAAGACTCGCTTGTTGTCAAATGCGCCGCCCATGATAGTTGCCTCGATGCACTTGGTTGACACTTTGACAAACCCCAATCTTGTCCCGTTGC
ATAGGCCCTGGGAGGGGCAAATGTTGGGCAAAAGCATGACTGGACATCCCACCTTGAACTCGAGCTTGTGCGGTGGCAAGCCGCATATGTTGATGGAATT
CAGGAACTCGGAGGGAAATTCCATGGCCGTGTCGTCAACATCCTCGCCTTCTTGCTCGACTGAATCGGCTGAGAGGCAAGTGAACATGGCAGAACTGTTC
ATCTTGCGCAGCACTTTGGCGTTGTACTGTATTCATCGACCCCGACGTTCTTGGGTGCCAAAATCGCTCGTTCAGACATGTACTCCGGGGGGTTGGCCGG
GTTATTGATGTCGCCATAGATTTGGTCGATGTACGCGTTCAGGTCTTGGTCGGTTTCCAGTTCCTGGCAATTGCATCCGGCAGTCGGATCATGGGAGAGC
CGTAGATGTCTTGTTCTGGATACGTTCCGTTTGCAATGTCAACTAACGTCTTAACCCATTCCTCGATACTTGCGTCGTCTGATCCACCACGCAGCCGCAC
GCATGTTCTTTGTCAGCTTGACAATTTTCACGTCGTTCCAGATGCTGCTGCATCTGAAGGAGGCCTCCAGTGGCCGATGGTTTGCCGCGTGGAATGCTTG
GCAGGATTTGCTTGAAATCGCCCGAGAAAACAACAACCTTGCCGCCAAAGAGGGCTGTGGGGTTGTCCATGATGTCGCGAAGGGAGCGGTCGACGGCTTC
CAAAGAATGCTTGTGGATCATTGAGACCTCGTCCCGTACAATAAGCTTGGTGTCTCGAATGATCTTTGCCAATGACGACTGCTTCAGAATGTGGCATTGG
GACTGGTCGTTGATGTTGGTGACGGGGATTTTGAATCGCGAATGTGCCGTTGTGCCGCCCATAAGCAGCAAAGCTGCCAGCCCAGACGATACCACAGCAA
GCGTGATGCCCCCTTTGCCACGCACTTTTGCTAATAGGATTTGAGAGAGGTACGACTTTCCTGAGCTTCCTTCGCCTTGGAGGAAATACGCCTTGCCTGA
TGCGTGATCGTATATTTGGGCCAAAACGGTGGCCACAAAGGACCTGTGCTCGTCAGTCATGGTCGCAGCAGTGGCCAACACGTCGTCGAGGGCTGCACGC
GTGTACGACGTTACAATGACATAATGCCGACTTCTTGGATCGTTCAGTAGTTGCCGTTCGTCCATGTCTCGAAATACTTCGAATTCGTGGAGTTGAGGTA
ACGTCGGGTAGTCCAAAAGGCTCATCCGATGGTGTTGGAAGCAGTTGTCGATGCTCTTGAGTGTGTAGAACATCGCCTTGCCAAGCATCATGTCTTCACT
GAGCGGCTATGGGAGTGCTTCGTTGCAGCGGCGCAGGTCCCGAAGCCGCTTGTCCATGAAATCTGCTTTGAATTGGTCGAACAGAGCTCGCGTGTTCGCT
GGCAGGCAATGCACCAAGATGTTGGCAAACAGTTCGTGCAGCTGTCCGTCCATGCAGTCCAACGTGGCTTGTCGAATACATACCACATACTCTTTGTCGT
TTTTCAACAGGCCCATGGACAGTGCAGCTTCTTCGTACGTTGGATACAGAGTTCCGTGAACTGTGCGCAGAACTTCGAAGGAAGTTGGTCCATACTTATG
GCAAAGCAGGGTTCGAATGTAGAACCGCTCCTTTTGACGCGGACGGACCGAATCAATGTGGCCAATGACCTTGATGTGGTTCTTGCGTCCAACCCACAAC
TTGGTCTTTTGGTCAAATCGGAAGTACTGCGGGAAGTCCTAGTACAGGCAGCTTTTTGCAGGAACGCCGTCGATCCCGGTCAAGCCTTGCGCGCAAGCGA
GGAAGAAGGAGATCAACTTGGTCTTTTGGTTCCTGGCAACGACCGCTTCTGCGTCGTGGGTTTCGTCGTAGGTGCAATGCTGTTGATCTTTCTCGTGCAC
GGGCAATACTTCGACAGCGTGGGACATCCTTTGCAGGTCGTAGCAGCGAATGCGTGTGATAGCTTCGAGGAAGGTCACGTAGCGTCCTTCAACGTACTCC
CATGCTTCGTCAAGAATGGGCTGGCGTTCTCGGTCGGTGAAGACAGCGTACGTGATCCGATCGCTGCCCTTCCACACGTACTTGTACAACGGCCTTGATG
CTTGTGCAAACCTCGACGTTGATGTGGCAGTTGTACTTGTGCACCAAGTACGGGTTGTGTGGTACATAGTACTGGTCTGCGGCCATGTCGCGACGGTACT
TGGCATACCCATCGACCCCCTCGGTTGTGGTAGCTTGCAGGGGCTGCGGAAAGCCTTTCTTGCACTTGCCAGTCTTGTCGGTGCAAGCCCTCGCACTTGG
AATCGGCTGTCCATTGTCGTCGTATTGCACATGCATGTACGTATGGGTCATGAAGTACTTCTCTGACTTGTGTAGCTGGGGTTCTTGATCTCGTCTGGTA
TGCGCGCGGATACCACAGAGTTGATGTCATCGACGGTCCTGAGCTTGTCTTGGTCTTCCATGATGAGGAGCATGTGCACATGCGGCAAGCCACGCTTTTG
AAACTCTTCAACACGCACGGATGCGACAACCTTGCCAAGGACGTGTTTCTTGTGGATGTCGTCCTCGAAATACGTTAGCTTCGACTCAAACACACATGTG
ACAATGTCATCGCGTTCAGCTGACGTTTGATGGGGCTTGAGTTGGCTGATGATCTCCGGCCAATTGGGGTTGCACGTCATGGTGACGAAGAGACATAGCT
TCTCGTACTTGCGCACAATTGCCATGGCGCTGAAGTAACATTTCTTCATGTAACGCATGCTGCCAGTAAAGCTTGAAGGCACGATGGACTTGATGCAGAC
GTTGTGGAGCCCTGAACGTCTCTCGGCGGCCTCCTTTACGCTTGCGTACAAATCGAATCGCAACTTGTCTCCGTTCTGCGAAATGTAGCGCAGCCTGTTG
GTTTCCACGCAAACGAAGCCGACCGTAGTGTACATCTTGAACAGCATGGAGGATCGGTGCAGCATGTCGGAGAAGTCGTCGCCGTCTCGTTCTTGAAGCC
AGTAGTTGAAGAACGCATGGAGAGACAATGATTTCCCGTCGGTCTTCGTCATGGTGTACTCCCATCCAGAACCTCCCATTGGAAACAGGAGAGGAAACTG
CAACGCGTCGTGAAATGGATTCGTTTCTCGAATGGTTGTGAACCGGTTCGAGTTCAGACTTTGCAGAACCACATGACGGCCTTCTGTGGGTTCGCTGCCG
TCTCCCTCCATGATTACCGCAAGCTGAGCCACGGTAGGCAAGTTGTGCGTTCGAGCCTGCGCGCCACCAACGGCCTTCAGGACAATTTGAAGATTGCCCC
CGATGTCCCGTCCGCTTCCGCTCGACGCAAACGTTCTTTGGCAGTGGCATACTTCTCGCCAATGGGTTGTGGAGATCCATCACTCACTGTATCGTGACAG
TGTACCGCGAACTGAACGCCGGAAACATGTTTCGTCGGTGTTGAAGTTGCTCCTCGCTGGTGTGAATGTAGATTTGGGCAAAACTTGGCTGTCGCAGCTT
TCCATTTCTGTTAAGGCTGGGCTGCAACGCACTAATGTTGTGGGTCAGCTGGCCTTGAATGCAATACGTCTTGGGACCGCTGCCACTGTGCTTGACCTCG
TTGGTTCCAATGGAAGTGAAGTTGAACCGAGCGTTGTACTGACGGATGTG