Description :
From Genome Similarity Track
Location :
Scaffold_1123:464- 5647
Sequence
5183 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGCACGACTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTATGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGGGGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCATGTGTGGTCCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGATCGACTCGCAGTACGAGTCCGTTCGTAAGATGACAGGCAT
CTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGCGGGCTCATCGCC
CACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCTTTCGAAGGGAAGGAAGGAGAAA
ACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGG
TCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCTCTGTCT
CTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAGCTGTTCCGTGTGCAAGC
AAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAAGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCACGGTATGTCAGAGCAACCCTGTCTCT
GGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACCGGCCGGTTCCCATGAATCTGGGCATGGCCGAGCAGAGCGACATTCGTTGCTACGGCT
GTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGAAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCC
GCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCC
ATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCC
CTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTGCGCCGATGCGCTACGAGGCAGC
AAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACA
GCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGTATGCCGTGGCTGGAGAAACATGAGCCTTGGATCGACCGGCGCGGCAA
GGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGATGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCACCCGCGAGGGCCCCCAGGGC
GCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACC
AGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGACAGCAAGAGCTGCTGGAGAAAGCGCCGCTGGCGTTGGCGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAAGGACAAGGCGGGTAACGTAGTTC
TGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCCGCGCCTCGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGAC
GACGCTAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACA
GGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGA
TCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGGCATGGACCAGGCAGTCCTAGAGGAGTTCCAGAGACAGCG
TGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCC
AATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCTTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTG
AAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAA
CGGAAAGTGGTGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACGGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATG
GTCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGTTACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTTACGGCTGTGAGCACGCCGA
GCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCAACCTTTGCGTGC
GTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTC
GAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGG
TCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCA
CAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTT
AACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTG
GCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCATCCCAACGGAACTATCCAGTCCACGA
CAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTCCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGG
ACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGTTGTCATTCTTCACGGAATACAACTTCCGTGTCGAGGACAAGCCGGGCAAGTTGA
ACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGAACGCATCAGGCTGGGGTACCG
AGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGACCGCTGGCTCGGAAGCCAATGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGC
TATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGA
TGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGGAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGT
CGCCACCTACGTCCGTACGTGCGAGACGTACCAGCGCGTGAAGCCTGCCGGTCACGCCTCGACACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGG
AAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACT
TTGCTCCAGTTCGTGACATCGTCACTGGCGACAAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGA
TCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGC
CAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCG
CACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTAACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGG
GGCTTCGGTCCTAAGTAGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCC
GAAGACAGGCTGAAGATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGA
ACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATATTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAG