Description :
From Genome Similarity Track
Location :
Scaffold_1905:464- 2994
Sequence
2530 bases(100 bases per row)
CTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATC
TCAGCCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCTGA
GAGGCTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTC
CTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGGCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGG
ATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGA
TCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAGCGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAGCAAAGTGT
CCCATCCGCCAGATCCAACCTCACCCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCGAACCAG
TACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCAT
CCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCC
CCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGAT
CCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAAC
CACGCGCATCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTC
ATGTAGATCACGTGTATTATCGACTGGATATAGGGTCCTGCTACCTGGGTCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCG
ACTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCG
GATCAGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTC
TTGCCACACTTCTCACAGACCAGATGGTTTCCAGCATCCAGATTCTGTGTGCTTTTGGAAATCCGCACTGCGAACACCCTGATTTGCGCTGTCCCATCCA
TGAGATCTCGGGATCTGTACATCCCACGGTCTCCGGGTACGGTATCCCCCGATCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGATGCAGTGAG
GCAGACCCGACGGTAATCCTCTGGGTCTGAGTCCAAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGGAACTTCGTGACTTGGTGGACACGTCGAG
ATGGAGCCGTGGGCGTCGAAGCCTTTTGGCGATACTTGTCGGATCCGACCGTCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTC
TTCAAGCTCATTTGCGTCTGGAAGACGTAACATGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGT
ACCTTGGATTCCCCGTCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAG
CATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAACAAATCTTGCCACTTGTTCCTGGTGGATCTGCCCAG
CTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCAACCGACGCTTGATCTCTCATGAGGGCTGACTTGACT
TTGCTGATCCATGTTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACG
ATCCACCCGCCCCGGATGCGGCTGATGCTACCACCGCTGACGAAGGGGATGGACCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTC
CACTGACTCCATCTCCACGTCTCGTGCTCC