Description :
From Genome Similarity Track
Location :
Scaffold_1271:464- 2084
Sequence
1620 bases(100 bases per row)
AGTTATCCTCTCTTCGCGACCGTGTGCGCCAAGCTGACCGCAAGTTGATCGCCCTTCGTGCGAGTGCTGATCGTCTACGTGAACTCGAAGCTTCTCAGGT
GCGTGTGGAGATCGCCAACACTAGCCGCCTTGCCCGCCAGGTTCTCACCGAGCCTGCTTCTTCTCAGGCTTCCGCAAATCAAGAGCTTGCTGCCGCTCGT
GTACATGCTGATTCCCGTGAGGTCACGTCGTCGAGCGCTGAAGTCTCACAGCTGCGCGCCCGTCTCGACCTGTACCGCGAGGAGCGCGAGACCGTGGCGA
TCGAGAACAGCACGCTTCGGCGTGAGGTTGCCGAGATGCGATCGCGTGCTGAAGCCGCCGAAGCTCTAGCAAGCGCGTCAATCGCTACGTCCAAGAAAGA
GGCGCATCTGCTCGCCGAATATCATAAAGTCGGCAAGCTTGCCGTCGTGCGCCAGGCGAACCAAGACCTCGCCGGCTACAGCGCACTCGGCACCGCCGCG
GAAATCCGGCGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGACGCTGCAACCGTGCAGTTCTTGACGGCGATCTTGTCGCACACACGTGAT
GCTCTCGCAACCTACGAAGGGCTGCTTGGTCCGCTGATGTTGGCGACCTTCCGCCAGTGTGGCGCTCTCGATTCGGCCATCTCGATGCTCCAGCGACACC
GCCTGACAGCTTCCTCGGCTCCCATGTTTGAAGGGTTCTCGTAAATTTCTCATTTTAATGCATTTTTGACTACGGTACTCTCCTTGGGCCGGTTATCTCA
GGGGTATCGCGCCTCGCGCCCGACAGCTACTCGATCAACGGTCAGTCGGCCGTCGACATCATGGCCCGTGCCATCTCCAACGCAGACCCGTCGTCTTCGG
TCACTGTGGGAGACGAGCGTCGCCGACTCGTCGAGCGCTGCACGCTCCTTGTCCAGGAACTCAACGCCGTGCGTCCCGATCCTGACATCGCCCGCTTCTT
GGCTGATATCGATGGCCAGCTACTTTCGATCACCCGGTCCAGCGATCTCGCGGAGGAGATTGCCGACGCCCATAACGCCCAGTCTCATTCGCGTCGCGAT
GAAGATCGCGACCCTCCTGCCGGAGCTGGCGCCGCGCCTGGCGCTAATGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTAGCTCGGCACCTTCTCGCAATCGAGAAGCCGGTTCGAAGTCCTCGTCGTCGAAACGCTCGCGTCCCTCGGGTGATGTGGCTGACTCTGCCGGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCGACTTGACGAGCAGTCCGCCGCTGAAGTCGCCGTCCCGAACGGC
CCGTGGCTCCAGCTATTACTCGCAGCCGGTTCATGAGACTTGCCGCGCGACTTGGGGAGACTGGTGTCCCGGTTGGCCTGAGAGCGCACCGACTCTGGTG
CCCACCGACCTCCTGCAGCTTCAGCGTTTGGCGTGGAAGTTCGGCTGGTTCCGGAAGAGAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCAAACCA