Description :
From Genome Similarity Track
Location :
Scaffold_18:46399- 48143
Transcript NameFunction/comments
Albla_Nc14022060
Albla_Nc14022070conserved hypothetical protein
Albla_Nc14022080conserved hypothetical protein
Albla_Nc14022090

Sequence
1744 bases(100 bases per row)
CTTCTTCGCATTTACCTCATGCTTATCAATAGAGTTCAAGACATGTACTCACCTTGATGTATAGCCATCCAGACCGACGTAAAAAAAATTGCAAGCAACA
GAAAGAGTAGGGACGACAGCAGTGGTGTAGGGCGACAACACATTGTGGTATTGATGAACAAAAAACTAAGGACAAAAACTACGTGAAAAAGAATAATTGG
AATTTTCTAATCTTTCCAGCATGTGTAAATGATTTTGGGTTGAAGCTTCCTTACGCTGATAGAGCATAGCGCAAAGTGTCACATACTCGTCTTTGGATGA
ACATAATGTCAAGGGGTCGTCCCAGCTGAATCTATTCCAGTTTAATATGGAGACAGCCCATAGATCGGAAATTTGTTGGCTTGCGCCCGCAAGTATCAGT
CGATGTCTGACTTGCCGTTGGAGCCTCGTAGCGATTTTCTGTGCGCTACTCGGATTCTGAGCTTGGAAGACACGAGGCTGTGATTCCACCAAAAACCTAT
TGCAAATATCATCATTCCCATAGGGTAGTAACGACACCCTCAATGTACAGCCTGTCAATGCGATGACACCCAAAAGCACACCGCCGCGTCGAGTGTAATA
CTGCAACATTCCTTCGTCCAGAATACAGTACACAATAGAAATAGAATCATCTTCAATCCTCAAGAGATATCCTTCTGCGTTACCGAAACTCATCCGTCTA
TCGATTAAGTAAGAAAACAATTAGATGGCTCTTCATTAGCGCTCATTCGGCAGAGGAATTGTGGAATAGTTGAGTTGCACTTTACCATCTGATATCCTTT
CTTTTCCGATGCACCTTGTGAATTAATCCCAAGCTGGAAAATGCTAAATGATGGATTGCGGCAACGACAACAAGTACTACCACCTCCGCCTGCGCGTGAA
GCATTCCGGCACTCATACAAGAAGGATCGAAATACCAATCCTGGATACTATGACTGGATAGTACCTTTTATTCCGCCAGTGTTACGAGTAAATCGAGACA
CACGAGTCACAGCTTACTCGTACATCAAAAACAATTTTCACCTCGATGCATTGCGTAAAATGACTTGCTTTCTATGGTCCTACAAATTATGTTGCGTAAA
AATCCTCACATCTAGTTTCTTGTGGCTCCGATTGCTCTCATGGATTCATGCGAACGCAGCAGAATTTGCAAACGCCTTTGTCATTTTCAGCGGCTTGGCA
CTCATTGTGTACAATTGCAACAGCGCAATCGATAGTGCAGAAAGTGGCAATAAGCCGTTAAGTGCATACTCTATCTTCAATCCGAATGTGGAACGAGTAT
TAGGTTCTTTGACAGCCGAACAGGTTGAGGTGAGTGGGAAGATCTTGAGCACTCAAGACTTATTATTGTGTACGTTAGAACGAAATACGTCATCGATCGC
CTGAGTTGGAGCACGAAAATTTAAACGAAAAAGATCTGATGGCAGCTGGTGATTATGAGGACCCGTAAGAGGTATTGATGGCATAAGGGCGCCTGGTATT
GACAGCTTTTTGATCTTATAGTGAGTTGATGCGTGCCATCGAGATGTCCTTGCGAGAAGCAGAACGACAGCGTGATATCAACAAAACGATACGAGATGCT
AATGAGTGAAATTTGGAGCCCAACAGCGTTGCCGATACAGTACATTTCCAATTCCGACCGCAATGAACGATATCAGCCTGCCTACTTTTTTGTAAAGTCA
ATATACATGACTTCTAAAGTCGTGCACGTGTTTCATAATGGTGT