Description :
From Genome Similarity Track
Location :
Scaffold_59:46389- 47633
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_59-fgenesh-gene-0.3Endo-beta-1,6-galactanase

Sequence
1244 bases(100 bases per row)
GGCTGGggCACGTCGCTCGCGTGGTGGGCCAACATCTTCGGCACCCGTGCTGATGTGGCCGACATGATCTTCACTGCCAAGGACGCCGTGGCTGTGGCTG
GCACGGGCACGGTGCCAGGCCTCAACTTCAACATCGCCCGCTACAACATCGGTGGCTCGGGCAACAACGTCATCAACGACAATGGGCAGAAGGTGACGAT
GCAGGCGTCCAACAAGATGCCAGCGTTCCGCTTCATCGAGAGCTTCTGGCTCGACTGGTTCAACTCGGACCCCACGTCGAGCAGCTGGAACTGGAACGCG
GATGCTGCTCAGCGCGCTATGCTCGTGGCGGCCAAGCAGCGTGGCGCCAACCTCTTCGAGGCGTTCTCCAACGCCCCACCATGGTGGATGACCAGCAACC
ACGCCGTGGCCGGTGGCAaGAAaGGTGGTGACGACAACCTGCAGAGCtGGAaCCACGAACAGTTCGCTGGCTACCTCGCGACGGTCGTCAAGCACGCTAA
GGACAACTGGGgCGTCAACTTCCAGTACGTCGAGCCGTTCAATGAGCCGATGGCCAACTGGTGGACGTTCCcAGGCACGCAGgAGGgTTgCCACTTCTCG
ATCGACACGCAGAAGTCTGTGCTGCTCTACCTGCGTAAGCAGCTTGATCAGCGTGGACTCCAGAGCGTCGCCGTGGCGGCGTCGGATgAGAACTCCGCTG
ACCAGGCGCTCTCGACGCTCAACACCTTGTCCAAGACCCAGGCCGTGACCAGCACTTTCACTAAGGTCAACACGCACGGCTACAGTGGTCTGGACGCCTA
CCGTGGCAAGAACCGCGGTCCACTCCGTGACCTCGTCAAGAAGCTAGGCAAGACGCTGTGGGACTCAGAATACGGCGAGGCGGACGGTTCTGGCCTCACC
ATGGCCGAGTCCATCGGCCTGGACATCAATGACATGGGCGTGTCGGCGTTTGTGTACTGGCAGGCGCTTGACAGCGGCGGATGGGGTCTTGTGCAGGCGA
ACCCGGGAGACAACTGGATGGGCACGCCAAACGCGAAGTACTACGTCATGGCTCAGTACTCACGCCACATCCGTCAGGGCATGCAGATCATCGGCAGCAA
CGACAAGAAGACCGTCGTCGCCTACGACGCCGCCACGAAGAAGCTCGTGCTGGTCACGGTCAACACTGGTGCTGCCCAGTCGATCACGTTCGACCTCTCG
AGCTACTCGTCGGTCGCGGCGGGGACAGCCAACGTCTGGACTAC