Description :
From Genome Similarity Track
Location :
Scaffold_1:4638684- 4642605
Sequence
3921 bases(100 bases per row)
CACGATCACGACCCTCGTAATCATGCTGCATCAGCGCACATCCGATTGCGAAGTCGGATGCGTCGCACATAACGTGGAACGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCAGTCAAGCCCAGCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCGGTCCAAACCCACTCGGCGTCCTT
CTTCAGGAGCTGTGACAGCGGGCGTTCATGCCCGCGTAGTCATTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGACACTACCGGAGTTCCTTGACGT
TCGACGGCGTCGGCCACTCATTGATCACTCTGACCATCTCAGGGTCAGGGCAGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGT
CCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCCTCCGGAGATGCACCTTGTGCATCTCAGCATCGCTCATC
CCGTCCGCAGCCCGGCTGTACACGAACACATCGTCAAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCCGTTGAAGGTCG
CAGCGACGTTCTTCAGACCCTGCGGCATTCACTAGTCACTCCCAGAGCATGACGCTCGGCGTGCTCACTTCCGTGAGAGGGATATCGCTCTCACGCATGA
GGATCTGATAGAACCCATCGCGCAGATCAAGAGCGCTGTAGATAGTGCTCCTGACCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGC
CGGTATCGTCGCATCGTTCAGCTTGTTATATGCATGAACGATGCGCCAGCCGTCCTGTGGTTTTTTGACACAGAACGTCAGAGCACTGTGCGGGGATTTC
GATTCCCGCACTTGTCCAGTTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACATCAGCGTGACATAGTACT
TCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAACTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGAT
CTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTGTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGCGTCCTCGCTCTCAGTGGTGGTC
TCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCG
CGAAGCGCTTCCAGCTGATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGGGTCATCTCCCTGTACCGGAACCCGGCACAGGT
ACGCGTCAAGACCTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGC
AGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGATAGGTGTTCTTCTGTAA
TACCGCCGGCGGGTTCATCCCGCGGGTGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCCGCTGCACGACAACATGCAAGTTT
TTCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGATCTCGGAGCCGACACGCCATCTTTACCTCGACGCCTGTTATTGGCGGTGCCC
TCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAATCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTAT
TATTGGTCAGCCCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGGTCGGAGACTCTTC
CTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGATTGCTGCTCTTGCGCGCGCGCC
CAGGGCGCTCCTGGACAGCGGCATTAGGCACTGTCTCGAGTGGGAAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCACTCGCTGT
TCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACTGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTA
TCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTATCGTTCTTTACGAAGGCACCCG
TTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAACCCTCGAAGTCAAGCCTTGATAGACTTCGCACTCGAACAAAGTTCTTCGACGCGCCAGA
ATCTACCAAAGCACGAAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTTTTGCAGTGAGAATGAACC
TCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAGCTGCATTACCAGTAGGGCGCCCCGCGTCTACTGGCGTCCAGCGTTTTT
TGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAATGTGACCGATTCTACCGCATTGG
TAGCATCGCACATTGTTTCCTTGCGACTGCTGGGGTCCAGCAGTTGCAGCGCTCGAGGGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTATCGGGCGAG
GCTGTGGCCTCGGCGCATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTGATTGCAGCTTCGAGAGTACTCGGGTACTC
ACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACC
AAGTACCGTGCTCTCTGAGCGTAAACATGGACATCATGCTTGCCCTGCTGCAGGAAGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAA
AAAGTTGTCTGAGCTCTTCCTTGAATCACTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGTATCCATATGCCCAACTTCTTGCACGTCCGCCAAG
ACATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGAAAAGCCAACGGAGGAGAGGCTCGCCA
TCTCTTCCAACGCAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCACGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCC
TCATGATGAATCCCAGACCATGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGC
TTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGG
TTCTCAGCTCCGCGTTCGTGCAGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGTGCTACCAGGTGTAATGGGCCTACTTCGGCTCACTACTTTAGC
TTACACGTGTGCACGTGTATGTGAGGAAGCGTAGCTTAGTTTAACTTAGAGTTAATTATACTCGGGCCACCGAGTTATCTTGATGAATGCTTGAATAGCT
TAGGTGCCGTTCTTGAACTGT