Description :
From Genome Similarity Track
Location :
Scaffold_1019:4638- 6151
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1019-snap-gene-0.5Gastricsin
Pytap_DAOMBR444maker-pag1_scaffold_1019-snap-gene-0.6Gastricsin

Sequence
1513 bases(100 bases per row)
TGACGAAGCGATCTGTGTTCACTTCgggTAAGGCGACGAGCGCCGCCATTTCTCTCAGTGCCACGTCGCCTCATGTCATTTTCAATGGTGTCGATgaaaa
CTTTGTGGCATCGAACGCCATGGTTGATACCAAATACGTCCTAGGTGATTACACGCCGTGGGGCTTCCCTGTCAAGATGTACCAGTTGGATAATGCGATC
CACTCGACAAGCCAGTACTGTAGTTCATGGTCCAAGGAtGGctGTTTTGCAAaGTTAGATACGCTCGACCGCCGGATTGTGATGCACTACAGCGACTTCT
CACATATTGAAGACAAGTATCTGAAATCATGCAAGCAGGACTCCAGCCGTGATTTCTACGCGTGTCCATCGGGAAcGAAGCTCCCACGgATGgCATTGGT
ATTTCCCAAGACAAGGCTGCTGTACATCGAACCAGAGGACTACTCGACACCGGGTAACGGAACAGGCAGTACCTTTGTCTGGTTAGCGAGTTCTACCGAC
AACTGGGTACTCGGTGTGCCTTtCTTCAAaCGCCACTACACGCTCTTTGACAACAGTGACCAGAGTATCACGGTCTATTGTCAGGACGGCGTGAGCTGCC
AAAATGGCACGCTCGAGTTTGACACGTCGCCAGGCGCTTCCTCCtCGTGGACGCCGACACCGACAACTAAGCGGACTAGCAGCGACCACAATGGCGCCGG
AGGCACGGTGATTGTGATCGCAGGGAAaGGTGGCGTCAAATTGGctGTCATTCTTATCGTCGTAGGTCTGGGTgTCGTCTTCGTCATTGCGAGTGGTCTC
TACTACTGCTTTTGCGGGgTCCACCGTACAAAGCCCGACGATGAGCTGCGAGAAGATGAACTTCCGGATGCCAtcATGGCAGATACTCAGACGGCAATGC
TCGTGGGCCAGGCGCCTCCAACTGGGTCGTGCATGGttGCTATGTGACTGTGTCATCCCCGcGAGCTGCAGTGCCAAGGTTGTAACGTGGAGGCAAAGaT
GTAAATCATGGCTACATGCACCAACACTCATGTGCACTtACTGATCTgTCCAGCACGCTTCAAGTTCTGCcACTCGTGGCTCCTCCTCCTGCTTTCTCAC
GCAATCGCCtcGCTGTgaTACTGGCTACAGTGCACTGTATGCTTCTATTACCAAGACAGAAGGAGACTGGATCTTGACCAGATGGGAATGCGTTTGGgTT
GATGGACACGGCAATCGAAGGgCGACATAGAGGAGCACTACGTGAGTGGCTACTATGAGCCTCATATtCGCACTCTCATTTTCGCAACGTACCACATAAC
CACCATtgATGCTAGCACGGTGtCTTGGTGCCGCAGCAGCTCTCGCTGCCGGTCAAGTATCGCTgTCGCTCACTGGGAaTGGGACGTACTTGGCGACAGT
CGAGATGGAGTCGATCCCAGTGAAGTTGCTGGTACGCCTATATGGGGgACTTGTGGGTCAAGTGTGCGGCTATAGAAGGCCCTTCGTGTGCCGATGGGAT
CACAACACGGACG