Description :
From Genome Similarity Track
Location :
Scaffold_161:46378- 51580
Sequence
5202 bases(100 bases per row)
GCTCAGACAAACGTTTGAACGTCACGGTCTGATTCAGGGCTCGATCAGATCTCCTGAAACTCAATGAGGGTAAGCGTGATGTGCACACTTACGCCCAGCA
CGTACGACCCGTTGCGAGTTGTATCACGGCCAACCCAGTCCATGAACACACATTTACCACGGTGTTTATGCAGGGTCTTGCGGATAGTCCCGTCAAGACC
CACCTGTTCCGCTTGAAACTGGATACGCAAGAAGCGATATGAATTGCGGAACAGAAAGACTTTAGCTTCAGACAAGCTCAAGCTAGTTCGGGTTCTTGTC
GTCCCGGGGGACGACAAGAAGTCGGAGTTCCAGAACCTATGGACCTCTGTTACGTTGAGAGCAATAGACCTCGCTCTTCAAACAACAAGAGATTGCAGAG
GTGCAATTGCTGTCATAAACCAGGACACTTCGCCTACTAGTGTAGTGCCCTACGCCCAGTGTCTTGAAACACTGAGCGAACTGATCTACCATTTGCCAAG
AAGGGCAACGGACGCGGGTCCAACGTTGTTGCTAAATCGCAACAGCGTAGCGGACCGTCAAAAAACGGTCAGGGTCAGTAGGGGCAAATCATCTACTGAT
CCATCAACCTCAAGAGAATTTGCAAATCTCTTGATGAAAGTTTCTCCAGGCTCACAATCACTGTGTGTCTCTGCACTTGGTGATGAGGTCATCACCTTGA
AGTTGGAAGTGACAGAAGATTTCTCACTTCATGCCCTAGTAGACTGTGGGGCGTCAAACAACTCTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGCTCAA
TTTTGTTGAGCGCGATATCCCTCCGACGAGGATGACGGTGCGCCTAGCAGCAGGCGCATCGATAATATTGAAGAAACGTCTAGTGGGACTTCACTACACG
CTAGAATTTTCTCAGTAAGATGATCATTTCATCGTACTGGATTCGGATGACAAGTTTGATTTCATCCTAGGTTTGCCTTGGTTCATAAAGCACCAGCCAA
GGGTCAGCTGGCAGCATCGAACCGTGAAGATGCCTGCAGCGTGTGGATGTACTGCGAGTGAGTGCGATGGCCTCACTTTCGGTACGGTCGTTAGTACGAC
TGCACAATATCACAGTGTGACAACGAATCACACTGTGGAGGAAGCTGTTGGCGGCTGTGCGGATGCACATTCAGAGCCGAAGGTCCACCACTCGAAGAAG
TCGAGTGGATCGGGACATGGGTGTACGCCTAGCGGGTGACATCCAAGGAATAATAAACCGGTTGTCCACACAGGCATCCCGATGATCCTAGGTCGACTGG
AAAGTCGACCGTAGAGGACCTGGATGAGGTAGCGCAACCACAGTTAGAAGACGTCGAGTAAATAAGTCCCGACGTACTTGAGGAAGAAATTCCTCAAACA
GTTATTGGTGAGGAAAGAAGACCTCATCAACCTGAGAAAAAAGTCCCCAGCAGCCTGTGAAAAAGGGTTCCCAGGAAGAAACTAAGAGACTGAATGTCTT
GGTTAATGAAGGGTCAAGTGTAGGTGCTTATACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCTGAGATCACTCGAATGCCCACCCTAGGACAGAAG
AGGTTTTGGCGTGATCTTCGTAGTAGCATATTCAAGCCGATATGCGTACTCGTCCCAGAGGACGAGTATGTCACCGATATCCGGTCGGCAATGGTCTTTG
CTGAGAATTAAGGGTTCTCAGCATCTCAAGAATGGACGAGAGTGTCCCTGATGAGAAGACTGGAATTGAGCGATATACATCTCAGTCGTGGGAATCGCTC
AAGGCAAATCCTCTCTACGATTATTTGATGAAATTCAGGGATGTATTCCCAGAAGCAATCCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCACGAAA
TTGACCTGAAACCGGGTCTGAAGTACTGTGTCATGTGTCGACCGCTAGTACTTTTTCATGAGGCAGTATCAATGGCCACTGCCTCATGAAAAAGTACTAG
CAATCGACAAAGTCTTTGCAGATCGCTTAGCCAGCCCGCCATGTGATGGATTCCACCTCTCCACATAGCTCTCCGACCTTCTGTGTGCGACAGGCCATAG
GAGAGTGGCGGATAGTACACGCCTTCAACAAGCTGACTGCTGCCACTGTACCGGCTCAAACAGCAATACCAAGGAAAGATGTCATCATAGATGGTATAGC
TAAGAGTACCATCTTTTTATCCATGGATCTGATGGATGGGTTCTATTAGATCCTTATTCGCGAAAGGGACATTTCCTATACTGCAGTGAGCACCACAAGC
GATATGCTCTGGGAGTGGCTGGAGATGCCACAAGGATTAATTAATGCCCCTGCCCTATTCAACAGATGTGTTTCAAATCTGTTGAGACCAGTAAGAGACT
TTGCACCCAGTTACTTCGATGATGTGTTCGTCCATAGCCCGGCTATGGATGGACTGACGAATTTGAAAGTCCACCGACTCCACGTCCGGAATGTTCTTAC
ACTAATGCGCGAGCATAAGTTGTAAGCCAGCCAACCTCAAGAAGTGTATATTTGCTACTAGAGAAATACCACTTCTTGGGTCGTGCATCGTGGGCAAGCA
TGGCGTCCGGCCCGATCCAGAAAAGATCAAGGCGATCACCGACTGGCCGGTGCCTACAGAAGTCAAGGGACTTCGAAAGCTCTTTGGCCTAGCGGCGTAT
TTGCATAAATATTCACGCAATTACGCCGAGATGACTGTTCATATCTCTCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGACCATGCGTCTTTGGCACGGCCGAAACAGTACCACTCCTCGTGCAGCGAATGGC
GAATGGCTGTCATTATTTGCGGAGTACAACTTCTCCGTCGAGTATAGGCCAGGACGACTTAATGTCGTCGCTGACGCACGCTCGCGCCGGCCCTATTTCG
ATCCGGCTGCGCCACCCGACACTGGTACGACCACTGTCGTGGTACTGACTTCGAGTGTCCCGTCGTCAACCTTTGGAGGATATACGAAAGGCGTATGATC
CGGAGATGGTGCGATTGACTTATCATCATGCAACCATCCATGAAGAACCTCAAACAGTTGTCGTTAGTGTATCGATCCTCTACGGATGGATGTACAGTTC
GCAACGGCCAACTCCAATGTTCGGCTGTTACCGGCGACACGCCTCGTGTCGTCGTACCAGATCACGGTGATCTGTGATTGCGTATCATGTATATGTACCA
CGACGCACTTGTTGGTGGACATCGTGGTCGTGAGAAAACATATCTCACAGTGAGCCGCGACTTCTACTGGATCCGCCAGTATCAGTTCGTGTGCAAGTAC
ATTCGGGCCTGTGGGGTCTGCCAAAGGGTACAGTCTAGTCCTTCCCTTCATGCATCGTTGCAGCCTCTACCCGTCCCGACAGAGTGCTGGAAATCCGTTT
CCATGGACTTTGTCTTTTAATTCCCCGCAGACTCTCACAAGAACACTGGTATTCTTGTGTTCATTGACCGCTTCAGCAAGATGGTACATCTGGTTGCTGT
ACCTGAATCAATCAACTCATTGGCTTGTGCTCGTGTCGTTATCGACACGGTCTTTCGCCTTCATAGGTTTCTTCGTGAACTCTAGTCCGATCAGGACCCG
CGGTTCACAGCTGAGTTCTGGTGTTCCGTGTTCAAAACACTCGGAACGCGCTTAAAGATGTCCACGTCTGACCACCCTGAAACAAATGGTCAGACGTGAC
GCGCCAATCGTATTCTCGGAGAATTACTTCGAGGGTATCTTCAATATCTTTCAAATTGGAGCGGATTCTTGCCGATGTTGGAATTCACCATCAACAACTG
GGTGCATGCGTCGAAAACGCATACACCGTTCTTCGTGAACGACCTGCGCCATCCGCGTCATCCCACCTTTTTAGAGTGTGACTCTCGTTTAAGGGGGGAA
GGGATTCAATCGAGCGACCGTCAATTAGGCTCTCACTCGTCACGTGCTGACAATGCGGCCACCACGTTCGACTCCGATGTCGATCACATCGGCTTTGGTG
AAGAAGAGGAAAGTAAGAGCGAAGATGCTCTTACTGGTCACGATGCTGATCAAATCAGTATCACGCCTAATGCGTCCAAAGACACGCTCACAGAGGCGAC
AAGCGATCTTGCTACAATACTCTCCAAGAGCACTGCAGCTAAAGACAGCGAGTCAGCAGATGAATTAATTCTGGCTAGTGAAACGGTTGTCCGTTTCTTA
CAACACTCGATTGCAGAGGCGGTAGATCGACAAAAACGAAACGCTGACAAGAATGGAAGGGCAAACGTTATTTTATTTAATAATGGCGACTTAGCCCTAC
TATCTACGGTAAACCTACCTCGACACATAGTGACTAACGTGGGAAGTAACAAGTTACTAGCCAAGTTCATCAGTCCATTTCGTGTGCTGCGCCGCCTAGC
CAACGCGTATACGATTGAACTTCCACGAAAAATGTGCACTCATCCTACGCACTACGTCGGTCGCCATAGGCCGTACTATCAGTACAGGACTTCTTTCGGT
GA