Description :
From Genome Similarity Track
Location :
Scaffold_11:463734- 470391
Transcript NameFunction/comments
Phyra_75187purine nucleoside phosphorylase 1
Phyra_71287charged multivesicular body protein 1b-2
Phyra_75189signal transduction protein Syg1, putative
Phyra_75190translationally controlled tumor protein

Sequence
6657 bases(100 bases per row)
TGCCGGGAGCGAGTGCTCATATGCAGCGTGGAGGTCTTTCGCATACATTCATGTGCTGGTGTACTCTGGATCCCACGAGCGCCTATGCTTTTAGCATGGT
AAACAACACGCAGATATAACTATCATCTAACTTACTGTATTTTATTTCAGTTGGCACCAAGCTAGCAGACTTATAACTTATAAAGACTGGCACCGCTCTA
TGAATGATGCTGCTTGCCAATGGCTGCGATCAGGTCTCGCACGTACGTCTCGATGTCGTGCTGCGTGGCCTGAACGGTCTCAAGGACCTCGTTGTGAGAA
GCGGCCTCTCGCTCCTCCCCGGGGAAGAGCGCCTTGTTGGTGATCAGCGACAGGCCGATGACTTTCAGCCCACAGTGTGCTGCCACGATAACCTCAGGCA
CGGTGCTCATGCCGACAGCGTCACCTCCCACCAGTCTGAGGAAACGGCATTCCGTCGGCGTCTCGTAAGTGGGTCCGGACACAAAACAGTACACCCCCTT
ACGAACTTTGTGGGCCAAGCCAAGATTCTCGGCCACCTTGACGGCCAGATCCTGAAGTTTCTTGTCATAGCAGTTTGAAAGTGGGGTGAAGCGAGCGCCA
AAACGAGAATCATTTGGCCCGATCAGTGGATGCTGGCCCGACAAACCAGGCATGTTCAAGTGGTCGTTCATGATCATCAGGTCTCCGACGTTGAAGTCCG
GGTTCAGACCGCCCGCCGCATTAGTCACCAACAGATACTTGATACCCAGCAGGTACATAACGCGAATGGGCAGCGCCGTCTCGCGCATGGCGTAGCCCTC
GTAGCAGTGGAAGCGACCGCGCATGCACACAACACGGATGCCATCCAGGTCGCCGAACACGAGCTCTCCGGCGTGGCCCTCGACGGTGGATCGCGGGAAC
TGCGGGATATCCTCGTACTTGATGACTTCTTGGTTGGACAGGCACTTGCTGAGGCCGCCGAGTCCGGAGCCGCAGACGACACCGACGAGCGGCTTGGTGG
TGACGCGTTCTCGAAGGAATTCGTTGATGACATCGATGCGCTCCCTGGGCACGGCTTCGTCAGCTATTTGGCCCGTGGAAAGGCGACGCACGTGGTGCGA
AGTGCTGCCGTCTTTGCTACCGGCGAGCGTGGCGACTGAGCTCACCGTCGAGTGGGCGCGCGGGCTCATGCCGTCCACGCTATGGCTCTGGTGCTGGCGG
GTCACGTGTGCGGGCAGCGACAGCGGTAGCAACTCCGGCGTGGTCTTAAGATCGTTCATCATGGTGCGGAGGGACGAATGCGTTACAGGCGTTGCTCTGG
GGCGGCAGATTGAAGAGTGAGCGGGCTTCGCATGCCCGAAATGGCGCATAACGACTTTTAGTTGCAAGTTGAAGCCACGCGCGTCGCGTCGATCGGCACG
CATTCAGATTCGTTTAAGTACGAGCAAATGGAGCCACAACAAACATGTACTTGACTGAGCGCGCTTGCGGCGCCACCTCGTGCGAGGTAGTTGAATATCT
TGCCTGATTCTCGCTTCGGCTGGATCAGCGGTGGTTGCTTTCTTTGCGAGACTGTCACAGCGCGATACATGTATGCGCGAGTTGAGCTGCAACCTGCGTT
CGTCTACTGCCGTCGTCGCGTTGACAGCGGGGCCGTCCATTTCCCCGCTTGTCTGCACTGCCGTCCGAGTTACTTATTTCCCCCGTACAACTTGATTGCC
ATCGGAAGGCGGAGCGGAAGACTGTGTCCCAGTCTCGACAAAACATTCGTCGGTGACGGTAATTGCAATAACTCGGGAGGTGAAGATCTTGCTGCTGCTG
CGCAAGTGCGCACCTTGTTGAAGTGGTTTGTGGGTTTTTGCGTCGGCGGTGAGTCATCCTATCGCTGCGACCACTGTTATGGGCTCGCCATGAGAACTCG
AGGCTGGCCGAACCGTTCGCAGCATGGGATACGCCATCACAGTTTGAGAGTCACACGCGTGTTGCGAGCCTTCGCCGCGTTCAGGTAAGCTTGTAAATAG
GCCAGTTGTCTCTCCTCGGGAGGAATTGCTTGTCATGCTAGCTACCATCGTCTGGAACGTTGTTGCAAATGTGTTTGTGGAAGGCAACAACGAATAGCCT
TCATTATTTAATTCACCTTTACAAATCAACGCACATAAATGACCATATACGAGACTACCATATTTAATAAACCGTTTATTTAATTAAATGAGCAGAAGTG
AGCTTTTCTGATCTCACGCAAGGTCACTTTCCAAAAATCGCGAGGAGGACGCAAGTGGACCAAGAAGAAACCCAACAAGAAATTCAAGTGAGTATGCCGA
AGGGCAACGGAAGAGGTAAAGGAGGATACTACGCGGTGGCCAACGGCCGCGAGACGGGCGTCTACAAGTCCTGGGACTCGGCCAAGGCTCAGACAAACGG
GTACTCCCACAACCAGCACCAGCGCTTCGACTCGCAGGCCGAAGCCAACGCGTACATCGCGGGCTACAACGGCGGCACTGGCCAGAGGGGCAGCCCTCCG
CTGCGCGAATAACCTGCTGGTGCGCCGTGCCAGGCGCGGGGACTGACGCGAGTGGGTCGTTGAGGACGAAGCTGCTGTGGGATCTCGATGACCAATGCCC
CCGCCCGGCAATTTGTGTGAATTGTCGTCGTGCTACGAGCTAGGATACGTGGAAGAGAAGTCGTCTAGCCCAAAATGAAATGGCTTCACGCCCTTCTTGT
TGAAGTTTATTGTAGCAACTTACACGCAACTTAATCTCTGGTTACGTTGCTTAATAAAATCCATCCCGCATTACGAGGAAGGCGAGGAAGGCGCTCATTA
GCCAGGCACAGCAGACGACAAGAGACGCCATGATGAACATCTTTTCGCGCAAGAACAAGCTCGAGGACGAGCTGTTCAACATGAAGTTCACGGCCAAGAC
GCTGCTGCGCAACGCCAAGAAGTGCGACAAGAATCAGGTGGCGCAGAAAGCCAAACTCAAGAAGGCCATCGAGCAGGGCAACATGGAGGGCGCCAAGATC
TACGCGCAGAACGTGATCCGCGAGAAGAACCAGGCGCTGAGTTACCTGCAGCTGGCTTCGCGCATGGACGCAGTGGCGGCGCGCGTTCAGACGGCCATCA
GCATGGGGCAGCTCAAGGCCAACATGAGCGGCGTGGTCAAGGGCATGGACACGGTCATGGAGTCCATGAACGTGGAGAAGATATCGCAGACCATGGATCA
GTTCGAGAAGCACTTTGAGGACATGGACGTGCGCTCCGCCTACATGGAGGGCGCCATGAGCAGCGGTACGTCGCTCTCGACGCCCGCGGATCAGGTGGAC
GACCTCATTCAGATGGTCGCGGACGAGAACGGGCTCAAAGTTGCAGGGCAGCTCGACTCGGCGGGGCTTGTGGGCACCGAGCTGCCCACCACAGAAGCTG
CTCGCGAGAAGAAGTCGCAGGATGATCTGTCCATGCGGCTCGCGGCGCTACGGAAGTAGCCACATCAACGTTGTAGAGATTTCTGAGCTCTGAACCGAAA
TTTGCATACACGTATCGTAGCGACCAAGGTTTGCGCTGTTGCTGGCAAGCAGCAAGTTGCCTTTGCCCAGGTATAATAGTGCGCGGTTTTATTGCTCGAC
CGTTCTAAAATACTACTGTATGGGCTAGGTATTGCACCTCCATACAAACACTAGGTGTCAAATTCAAACACCAGGCACCTAAAACGCCGGCCACGCCGTT
GCCGTTCGACTAGACCATTGGCCTTTCGAAGCCACGTCAAGTGCGAGGTCACACCTCAGAGGCTAATCAGATCCAGCCGCAAGCAGTGGCGCAGACGGCA
CGGCAACGTCAGCGACTGCCACAAGCGGATCCTCCACACCGCCGGCACGATGGCTCACTTCAGCCTGCGGCTGCGCGACAACGTCGTAGCTGAGTGGCGT
GGCGACTATCTGGACTACGACGGACTCAAGCGGCTGCTGGAGCGGCAGCGGCAGATCGACGCGGCGCTGGCCGCCGCCGCCTCCAGCACGACGTTGGAGG
TGCGATTGCCCACTGAGAACATGGAGACCAACGCGCTGAGCGGCCACCAGTGGCGCCCCATGGCTACGGGCAGCAGTGCGCAGCTGGCCAAGAAGATCGT
CCACAAACTCGCGTTCTTGCGGCTCTCCGGGCCTCCGCCGTCGTCCGCCGAGTCCGAGCAGCTGCAGTCGCTGCTCTCTGCACCCGTCGCCTTCGAGGAG
GCGCTGGAGCATGAGTACAGCAAAGTGGAGCGTGCCTACGCCCGACATGCAGCACAATTGGCCGAGCAGCTGGTACATCTGCAGGCCCAGCACCGAGAAG
ACTCGCCTGCTACCGCGCAGGACTCGCTCAAGAATTCGCTAGTCGAACTGCATCGACTGCTGAATCTGCTGCACAACTTTGCGTTGCTCAATTACACGGG
GTTCGTCAAGATTCTCAAGCGCTACGACAAGATCGCTAGCTTTCCGGTCGACCAGCGTGAGGAACAGAAGAACAAGCTGCAGACGTTTGAGTTTGCCAAG
GCCCAGCGGTGCTCGAAGCTGCTGAAGCAGGTGGAGCGGTCGTTCGCTGACTGGTACTGCGACGGAAACACGACGGTGGCAGTGGCAACGCTCATGACCA
AGAAGGAGGACTTTGTGAATTGGGGGCATATTTATCTGGGCATCAAGGCTGGCTCCTGTCTCATTCTGCTCATCTGGGTGTGCTGGGACTCGCTCGTAGT
CCCTATGTTTCACAATGGACGTGAGAACCATCTTATCGACCTCGTGCGCACCCGAGCCTACCCCGTGTACCGTGGCATTGGCTGTCTCCTGCTGCTACAT
TGGCTGGTGGGAGTGTCCCTTTACGTCTGGCGGGCTGCAAGGATCAACTACCGCTACATTTTCGAGCTGAACCCGCGGCGAGCGCAGTCGTATCCGCAGG
TGTTTAGCGATGCCACGAACATGACCATCGTGTTCCTGGCGAATGTGCTGCTCTACTACAAGGTTGTGAATGGCTACTTCCCGGAGGAGCTGCTGCACCG
CGGCTACTATCCGCTGGCGCTGTTCTTGTACACCTTCTACTTCTACGCTATCCGCCCGTGGGGCCAACAACTTGGTATGCTTCGGACGGTGTGGGAAGTC
GTGTGGTCGCCACTGTATCCCGTGTCGTTCTTTCACACTTTCGTGGGAGACTACCTCACTAGTACAGTCAAGGTCACGCAGGACGTCAGCTGGTCGGTCT
GCTTCTTCGCCACGAAGGAGTTTTTGCGCAAAGACATTGTTCCAGCTGAAGATGGCATATCCGCCTTAACTACGACACTGGACCCGGATGAACCAACCTG
CGCTGACAATGTGTACTACGTGAACGTTGTGGTGCCTTTAGTATGCGCGCTGCCACTCTGGTGGCGCTTCCTGCAGAATCTACGCCGCGTGTACGATACG
AAAACGTGGTGGCCGCATTTGCCCAACTCTGCCAAGTACGCGCTCACGCAGGTGGTTGTGCTGTTCGGCCTCTTTCACCCTCTGCACAATGACAACAGCG
AAGAAAACGCCTCGAAGGTGCGCATGTTTGTGGTTGCGTGGCTGTTCCTGTTCACGGCTAGCTCGCTGTATACGTGGGTCTGGGATGTGACGATGGACTG
GGGCCTCGGCCGGCCGCAATTCAAGTTCCTGGGAGACTCGCAGATGTTCTCACGCAAGTGGGTCTATTACGCCGCTATCGTAGCTGACTTGTTCCTGCGT
TTTGCGTGGACACTAACGCTCATTCCACCGCGCGGTGCTGCTCGGTGGCTGCCGCTGTATCTGCAGCCTTTCACGATGGTTCTCGAGCTGTTCCGCCGAA
CCTTCTGGAGCTTCTTCCGTCTCGAGAATGAGCATCTGCGCAACACGCAGGGCTTCCGTCGCGTGGACTTCATCCCGCTGCACTACGACCACGGCGTGGG
CGACGTAGAAGGCAAGGACAGCGGAGACGAAGTGGAGCAGCTGGACTTCCGGGTCTTCATGCTCAAGATCTTGGCTGTCCTCTTCACCGTGCTGGGGCTG
AGCGTTGTTGCCATCGTCATTGAGCGCTAAGCAGCGTAAACCCTCATTATAGATTTCTTTGCAAATATCGTTGGTCGGTGGGGTGCATATTGACCATGAA
TGCAATGGCCAACGTATAAGAAGAACACAGCTGACAAGAATTGGAGTACATGAAAAGGAGGCATTAATTAAGGTTTAATGCGCGGGTCAAGGAGAAGAGT
CTCGAGCTGCAGACAACAGCAACAGACGCTCCCGTCTAGCGCTCGCACGCGCTTAGAACTTGACCTCCTTGAGGCCCCACTTGATGTAGCAGAAGATGGG
GGCCACGGCGCCGTCCGGGTAGTAGGCGTAGGCGAGGCCGGCCTCCGAGTCGCACGACTTGAACATGTAGAACTGCAGCTCCTTGAACATGGACACGAGG
AACTTGACGATCTCCTGGGCGTCAGTCTTGAACTGGGCGAGGTCCTCGTCGCTGGCATTCGTGGCCTTGAGGTGCTTCATGGTCTTGCGGAAGTACGACT
TGAGGTACGTCTTGAGCTCGGCCTTCGTGTCAAAGCCCGTCTCGATGTAACCAAAGCCGACGGTGTCGTCGATCACGCTGTTAACCGTCTCGACCGAGTC
ATCCACCTGCTCGTCATCACCGCCGAAAGCGTCACCGCAGCCGATGTCGACGTTGTC