Description :
From Genome Similarity Track
Location :
Scaffold_1175:4637- 5804
Sequence
1167 bases(100 bases per row)
CATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAG
GATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTA
AGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCTAGTAGGGATGTCACTCTCTCGCACAA
CTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGGTCTGCGTCCTAACACAGACGGGGTCCCAGAATCCCCTGGCTCCCCCGCTTCGAAT
GGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGTTTCGGGTTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCT
GGGATGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGTTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCAC
CACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCGTTGATTAGAAGCATTGGATACACCATCAAT
CGGGTCAGGCCGTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACACCGTTCTTCTTGATGATGATTACCACCGAAGATGCCCACGGGGACGTTG
AGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCCCCCTTTGAGCGATCGGTTT
CGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGACTTTCCCAGATCTTCTGA
CGTAGACGATCCACTTCTGTGGGTTCGCTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCG
CCATGCCTTCTCTTAGACCCTCGGCGTGTAGATCCCCGCTTTCATGGTAACAGACTTGTTCATCTTC