Description :
From Genome Similarity Track
Location :
Scaffold_6:463692- 467815
Transcript NameFunction/comments
Physo_336399Hypothetical protein
Physo_563452metalloprotease family M48X, putative
Physo_513833Voltage-gated Ion Channel (VIC) Superfamily

Sequence
4123 bases(100 bases per row)
CGTAGACGCAACCGGAATAATCGACATTGTTGTCTGCATCTTGGCCGTATTAACCGGAGTAATTCGGTGCTGGTAAAACGGAACTTGAAATTTGCCGAGC
CCAACAGTATTTCTCTTCCCATTCGTTGGTGGAACGAGGTTTCTCGAGCTCTTACGTGCTGGATTCTCGGCCTTACTGAATGAAGCGACTTTGGCCAGTT
CTCGCTGACTGTCCACGGACAGCCGCACTTTCAATGGAGAGCAGAGCGGACGCGTAGTCCTGAAGTCGCAAACGCCGCACACGACGCCACTTTCGGGTTT
TAGCAAGCCTGTTTCACCTCTGCGATGAGCTGCGGCTGCTCTCGGTTGACCAGCAATTTCTGAACGGTTTGTGTGCTTCGGTAAATACTACGAAGCGACA
GTATAGACGACAGCGCATCGAAGCTGATGATCACGACGGATGCGAGTGGTGACCTCGCCGTCTGCATGCACGTGGCTGCGAACAACGCGTGGGCTAACTC
GGCTGAGAACACAACGATCCCCGATACATATTCTTCGAGAAATGACGAGACGGAGGCCACGGCATTCTTGAACACCAACCTAATGAGCGGCAATAGAGCC
ACAAAGACGATCTGTGCGTGGTCGGATAGCGACGCGAATGCGGCGCTTAGTCCGGTGTAGAAGATCGCGATGTTGCCCTGTGAGACGACGACTTGGATCA
ACCCTTGGAGTTGACCTTTTACGTTCGGAGCATTGGCAATCGAACGAGAAGAGACAGGAACGGAGGCATCGTGAGTACGAAGGAGAAGGGAACCGGGTAC
GCCCAGAAGTTCGCGAACGCCACAGTGACGCACACGTGGCAAAGGGAAGTGGCCAAGGAGATCGCCACTAGTTTCCAGAGATACCGACCGACATCCCCTT
CATCTGGACGGTCAGCCCCACGCCGACTGTGAAGCTGATGACTCCAAAGCGCAGCCAAGCCCCGTAGTTTTTCTCCCATCCGTCCGTCGGGTTTTGGAGC
GGAATGAGCTCAAGTGCCACGACCAGCAAGAGCGCGGGTAGCGGAGTGAGTACGCACACGGCAATCATCCGAGCTCGAGACACGCTTCGGCTGTAGTCAT
CAAGCGCGTATATCCTCTCTAGCGAGTACGTACTGCGATGTCCGATTTGAAGTCGATTCCATGAGTGCTTTAGCCACTTGATAACTCCCCCTCGACATGC
GCTCCCCTCCTCTGTCTTTGACGGATGAGTGGGCCCCGCTTTGACTACCGCGTCTCGCTCTACTTGCTCCACTGGAACAGAGTGCATCATGGCGACCAGA
GTTGAGCAGAGTTGAAAGTCTGGACAGCTAATTTTAAGTGAGCGGCCATCGACGAACTTGATGCTCATTTCGATCAACCAAAATCGTCAAACATTTTATA
GGAATAGAAAGCGTTGCCAAAAATCACTATGTGAAGGAAACTTTAGGAACACTTGCACGAGTTTAAGTGATCACCACGGGGCTATGTTATCAATAATTAA
GTTACAGTTGTTCTGCCTTCGAGCTCAGTACACGTTCTCTTCAGCGTCGTCAATATCGGCGGTGACCATGAGCTCAATAGGCTCCGCAGTGGCCAAAAGC
TTGAGCCTTTCAATCCGCGACGTCAAGAGCGGGTGGGTCGTGTCCCCCAGGTAGTTCCCCCTCTCGTCGATCATCCACGTGTTGAGTGCCGAGCGCATCT
GACAGTTGCGGGACAGTTTCCGCTGGAAGCAGTGGATGCCTCCACGCGCGAATCCGCTCTGTGCCGCCACTTGATCCGCCTCGTGCTCCAAGCTCCAGGA
CAGGTACAGGTTGCCCCCAATGACTCCCATCACGCCGATAACGGCAGCGACCAGTTTGTTGGGGATCTTGTGTATGGCGAAGCAGCTGCCGACCAGCGAC
GCCGGCAGGAAGGCGCCTGTGAGCATGGCGTGGTTCTTGGCGATGTGCGCGCTCTCATGGGCCAATACGAAGTCGATCTCGTCGCTCTTCGGGAGGTCGT
ACTTGTCCTGGATGTGGGAGGGCGCGTAGAACGCGTCGTAGAGTTCCATGGTTAGAACGATGCACGCCCCACGCTGACCGACAGTGAGGTTGGCGCCCAT
CGAGGCCCCGGTAGATTCCTCCCCGACACGGATGGAGATCCGCTCCGGGTTCTTGACACCGACCCGGGCCGCGATTCTCCGCACGTTGACTGCGAACGGG
TCCTGGCGGTCGAGTTCGTGGGCGTCCAGACCTTGAGCCAGACGCAGCGAGTGCGGGCTCGTGGGCTCCGCGATGGGGTACGCCGCGTATCCGTAGAGCA
GCAGCGAGGCCGCGCCGATGAAGCGCTTCGAGTACGCAGCCGTCGACATGACTTGGGTAGGTTGGTAGGGGGTAGAGTGTGTGGTGTGTGGTGGAGTTAG
TTCACTAATGGTTTGATACGCAAAGAGAGAACTTTGCGGTGGTGGCGAGCGCTTAAGAGTTAATGCAGTGCGTGTCTCTCGTAGCTCGGTTGAATATGCG
ACTTTGTATGGTGCTTGCCTATGCTGCCGCCGCCCGCCTTTGCTGCCGATTTCCGTAGATTTGAGCGTTTAGATTTCACTGCCGACGGATGAATGGAGGC
TCTCTGAATGCTGAGCAATCTAGAAGCGTTGGAGTGGTGCTTCTTGGTGGATGTAAGCTAACGTTAGCTGGGGCCTGCTAATAGCCGCACACTGCTGCAA
GAAGATCTCAATTATGCACGCACAAGCATTATGTTGACGCTTCGCTTGTGCTCCATGGAACGTTCGGATTGGCTGAAAAGACGAGTTGTCGCAAATGTAG
CCATTTCGGTGGTCTAACCATACATTCCTACAACTTCAACTCATGACGGGAAGTTTGTATGGGTCTGCAACCAGGCTGCCCCAGGCTCCACGCCAGGGCT
TTGATCCTCGGCTTCGAGCTTTGGAGACACATCAGAGGGCAGACTACGACGCGATCGTATCTGTCGCCTCAATCTGACCGCGTTGCGCTCCTCCTGCGTG
TGTTTGAGCATGTCGCCGCTCGTGTTGCTCCTTTTCCAGAGCAAATCCGCCAGCGTTTGGTTCCGTGCAGCTCTCGAGCGACTGGAAAGGTTCACGGGGT
ACCGGTCGACGTCCACTTGGGGCGTGGGGGACTCAGTCGTCGTTGAGATTGGAACCACCTCCGTCCGTGGAGACCTCACAGATCTTATCGAAGTTTTCTC
GCGCTTTGAAGGAGGCGGTTGGTCCACCACGTCCGGGTCTTTCGAGTTGCTGCGGATCCGGCGGAGAATTGTGATCGGAGCTTTGTAGTCGTTGCTGCGG
TGGGTGCCTCTAGTTTTTGATGGTGGTGAAGACCGAGGAATTGCGACGAGCGAGGCCTTCCGAGGTGCTTGGGCTTGATACTCTTCTTTCATGACGGGGT
TCTGGAATGATGCAACTCGGGGGTCTGAAGGCGTAACTACGTATCGTTGGTCGAGCATTGGCGTTGACGCTACGCGTGAACTTGTGCGAGCTTCCGGACG
ACCGCTGTTGCAGTTGGGACATCGACCGCCGTCCCGATTTCTCAATGCCTTGACGTCTTGCTGGAGCTTCTCCATGTTCTTCGCCATAGTTTGTACCAGC
TGAAGCAGCGATTGGTCCGACTGGTTATCTTTTACTGCTTTCGGCGAAGGTTCGGATCCCAAGTCATCCGTGGACGTTGCATCGTCGGCACTTTCGGTCC
GCGACGTGCGGCTAGAGAGGCCCCTCCCAGAGCGAAGGCTGCCACCTTGGCTCAAGAGAGGCGAATCAAGAGACGAATCCTCAATAAATTCCTGATCAAA
GTTCTGGAAGCCGTACTTGATGGACTCGTCCGGCACGTTAATGTCGATCGCCTCTACCAATATACGAGCGGCCTCTGCTGCAGTCATGGTTGCGACCGCA
GTGCCACGAGAAAAATCGTTCTTGCCACTCTGTCGGCGTTTCTCCGCCACCATCTGTATAATATTCTCCCAAGGGAAGGGAATCACGTTCTTTTCGATGC
AGCTCTCCAACATGGCAGTGAGAACGCGTCGACGATCTTCAGGGTACCGAGAAATAATACTCTGGAACACCTTGCGACTCAACACGCACATCTCCACAAA
CGTAATCGCTCGAATGTTGGCTG