Description :
From Genome Similarity Track
Location :
Scaffold_8:463641- 471746
Transcript NameFunction/comments
Physo_261739ATP-binding Cassette (ABC) Superfamily

Sequence
8105 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTATTAAGAAGTGCTGTGTGCCCCGTTACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATTGATCGTACGGAGTTTCCCCATATGAACGACTCGCAGTACGAGTCCCTTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCAGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGCGAACAACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCC
TCTTTGGTGGGGAACCCCCTGCCTGAACACATCAGGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTC
TGGTGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCAAGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGC
TGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGGCTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGC
CGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGCAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGC
CATAGGGACTTAGACCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATC
CCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAG
CAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTGGGGTCCACATGGACCTCAATGTCAAGTTCGAGGACTTCGAC
AGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCA
AGGCCATCGGGTCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGG
CGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTAC
CAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTC
CACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGACGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGA
TGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCT
CAAGGACAAGGCGGGTGACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCACCACGAGACGAAGACACCCGAGGGTCACGTCGT
AAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACG
GCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTT
CTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGAGGCAGTC
CTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGAATCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACG
TGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCTGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATG
GCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCT
ACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCGTGGTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACTGATCCCGCGCA
AGGACGTGTTGCTCAACAACATGGCTGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCC
ACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACA
CAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTACGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATC
TCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAAGAGATCAAGGTCCTGGG
CTGCTTCGTCAGCAGCGCCGGGGTCCGGGTGGACCCAGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGG
TTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGG
AGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGTGCGCGCCAGTCCTGGCATTGCCGGACAAGACGAAGCCTTTCAGCGTAGTCTG
TGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCC
GAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGAGCTCGACGCCCTTTGTCGTTT
ATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCAGAATACAACTTCCGTGT
CGAGTACAAGCCGGGCAAGTTGAACGTGCTTACCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGCACGACGGATCTGTATG
ATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCG
ACAATGTGCAAGGCTGCGCCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAG
GATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGACGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTATGGT
GGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTTCGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCT
GCTGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGC
TGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTATATCTTCCGACACCACGGTC
TGTCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCAGCACACAACTGTCGATGTCGACGGC
GGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGAT
CGGTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCTCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGC
TCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCG
GAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAATATAAACAGAATGAGTACTCTGAC
TGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTTCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCA
ACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGAC
GTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTAGA
AGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGTGCGGCGTACATCGGAGCAGCATACGCAGGGCCCCGTACGAGCCC
TGGCCAAACTGGACCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGTCATGAAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGG
TCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTACCAGCACG
AGCGGCAGCCTCGCCACCAAGACCGACGCCAAGCGCGATCTCGAAGACGTACACACGGCCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACC
TGACTCGGGGACCCAGCATACGGCTGCGCCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGTCACCGCTGGCCCTCCTTGATCGTAATGGGCAGATCCAC
TACCACGTGGAACGAGTCGACCGGGAGCGGCGGCTCCATGGCAAGCTCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGC
CCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACC
CGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGC
GCTTGCTCACGAGTTGAGCGAACTCGATGAGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATGCTCACGAAGTTCTTTGAACTCTTGGTCGGA
ATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACTCAGGATGG
AGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGTGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGC
CAAGAAAGAGTGGCTCTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGC
GCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCC
TGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTAGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTC
AGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGTCTTCGCAGCGGCAGCC
GCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGCCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCT
CGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGAACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGC
CTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAA
CTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCG
CGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTAGCCTCCAT
CAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGAAGGTGATTTCGCACTGCGCGCACTGCGCTTTGGA
GGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGAGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTG
TCGATGGATTTCGACTTTGTGAGTGAAATGTGCGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTACCGGG
GTTACATGAATAGTGACCCTGTCACTATTCAAGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTG
TACGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAG
TCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACAACTG
GAGAC