Description :
From Genome Similarity Track
Location :
scaffold_19:46362- 48552
Transcript NameFunction/comments
Plaha_PHALS_09589hypothetical protein

Sequence
2190 bases(100 bases per row)
GCACTTATCAAGTTCAGGTTTCACCAGCTTGGctcgaagccgtttgtgatctacacagctCATgagtcactacgcactgcgaataaatcgcctcacctct
cgcagagatgaccaggtggctcttctTTTTCGCATAATATATCTTCGATGTAAAAAGGCTTTGGCTAATGCGTTGTCGCGCAAatcggattatgagcttg
ctcatgtcacgacggtgacgtcgtcagtgacggatttaatCCGCGcccatacgcgggtgatggtatgtgtgtagcgctgctacagactctcgagagcaag
gagtttggaaactcggacaaaaaattgtcggtgcgattgcgcgcacgggtacaccgatattcgctgaataacgATTCAccgtattatagcaccgattcga
ctgatacgccacgaattgtggctcctcgcAATAAGGATtcgaaataccgtatccacTATGAGGCCCGTGACAcctcactcagtggtcatctcggttttga
gaagacgtacaactctgtgagttgccactactggtggcccaatctgtacaaatggacgagcacatgtgTGCGCACGTATGATACGTGTCAACGCGTGAAA
TTATCTCCGAATGcgacggcgccgctggccagtttaccggtaccctccaaGTGTTCGCAGTTCATAAGAATAGACTTTGTGTTAGGTCTGTCgaaagact
cggcgggcaacacggttgTGGTAGTCTTGCgggccgtttgagcaagatggctcatcttgcggcagtgccggacaccatcggcggtgtgggtacagcgacg
ctgtttgtgagtcgtgtcttttgacaacatgtaCTCCCGGATTCaactgtctctgacagagacccacactTCACTGTgatgttttggtcgacaatcttca
gtgtgccaagttgactatgtcaacagcgcaCCAtttgcagaccgatggtcaaaatgGGCGCGTCAATCGCGTCGTTAAAGACGTTCCTTGCAGCGTCTAC
GCTGAGATGCTGgagcgctggagcgcgatgctgccacttgtaagGTTTGCTCTGAGCAATGtggtgcatgcgtctacctgCTCACGCCTGTCTACGTGGA
TGAGCTTGTTATTCCTCGCgacccgctgacgccgccatcccatggctggGAAGGGAATAGTCGAGCGACTAACTGATGTCAGATACTTCACTATCCGTAA
AGAGGTCGATGACTTTCTGGCTACCAGACTgggtgtcctacgacacgttcgcgacgtgatggctgaaagccaagacatgcagaaaggaTATGCAGACAGA
AGAAGCAATAGATATGTTGAAAACGTTGAGCTCggaaacctaattaaaattgAATGCTACTGACCTTCCTAAACATTCAGTCTCTGCCTGGTTAAGTCGA
AGTTCTCTccacggtgtatcggacctGTGCCAGAAAAATTATATTCTAAAGGTGCTGCATTGGCAAGCATGTTCCGTGGGTAGGCTTAACAAAGAAGAGT
CATAGTAGAATAGCCAGTGTCACTATCCCAATAAAATTAAATTGTTGATTTGGCCTGGCCTGCCCCTTAAAGGGCATAGATTCTCATTAcacctttttca
aaagaaaaccCAATGAGGTTGGTGTGCggctaaaaaaataaatctgAATTTCTATCATACCGTTAGCATACTTTGCTGTGAATCGCACATACTGGTAAAA
AATTCATACGAATAGATTAGCAAGGAACCGgattatattttttttctgttAGTAGTGTTGCTGACGGCAGCGACATGAGCCGCTTGCTTAAACGATCCAC
ATATTACACGATCCTGGCGTTGCCAAACGTTCTCTTCAATTCTGCCGGGACCAGTCGACGGACCACACATCTTACAAGCTCCTTCGTATACTGCCAGACG
GCGCCGACGCACGAACCCGTTGATACGTGCTCGTAAAAGTGCTTACCCACTCGTACATTCTTGGCCCACAGTGTATTGCGCAGACTACTTCATATGCATT
TTCCCGATAGTAGTGTCATCCTACCGAGGTATTGTGTGCCTCATATCAATTTCGAACTTGAGGTCCCAATCGTGAGGTACCGTCACATTGTGTTTCAAGC
AGGACCCTGCAAAAGTTATACCTTGAAACAATAAGCAGCAAGAAAGCCCTTTTCTCCCAAAGCTTTAACCTTGATTGGGTTTGCGGTACG