Description :
From Genome Similarity Track
Location :
Scaffold_652:4636- 5798
Sequence
1162 bases(100 bases per row)
CGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTGACAGACGACGCTAAACGGACTATCCGGGTCCGGTAG
CGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGCGCGTCCTTCTTAAGGAGATCT
GATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTATTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACAG
GCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCTCACTTCCCAATGAAGCACCCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCA
CTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCAGCA
CGACTATGGACGAATATATCGTCAAAGTACGTTTGATCGTACGCCCGGTGGGGCCTAAGCAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCG
ACAGCCCCTGGGGCATCACCAGCCACTCGCAGAGCATACCGCTCGGAGTACTCACCGGTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTA
GCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCCAGGAATCGGCGTTTGCGCCGGGATAGTGGCC
GCATTTAGCTTGTTAAAAGCATGAACAACGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCA
TCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAAC
CAGGTCAATCTCATGACACACGCCTCGATCCAGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGA
TCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTC